AMCG00020953


Basic Information

Item Value
gene id AMCG00020953
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 37968172 ~ 38030972 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020953
ATGCTGGCCGTCACACAGAGGACATCCACTGAGGTCCAGAGCTCGCAGGATGTTTTGCTCAACTGCCATTTGCCTGTTATCACGATGGTCGCCCCCAGGGGCACCACCAGCACCCCCATAATGAGGTCTGCACAGGCCAGGGACATGATGAAGATGTTGGTGGAAGTCTGCAGCTGGGAGAAGCGTGCAATAGCAATGATCACCAGCAGATTGCCCAGCACGATAATCAGGATGATGAGGGCCATCAGCAAACCCCAAGGCCAGTCTCGTTTCGAGGAGTACGTGCAAGTCGATGTGACATCACATGTCATTATCCGCCCAGCTGCCAGCCAAAGAGAAAAGTGGTGCCCAGATGTGCAGCTGTCACTCATGGGTGCTAGGGGTGAACACGTCAAACCAGACTACGCCACTTCCATCACACCCAATTAG

Function

GO:

id name namespace
GO:0007189 adenylate cyclase-activating G protein-coupled receptor signaling pathway biological_process
GO:0071875 adrenergic receptor signaling pathway biological_process
GO:0045823 positive regulation of heart contraction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004940 beta1-adrenergic receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020953 True 429 mRNA 0.54 3 37968172 38030972

Neighbor

gene id symbol gene type direction distance location
AMCG00020949 LOC103357666 coding downstream 75832 37842900 ~ 37892340 (-)
AMCG00020947 nfu1,LOC101072203,LOC107752565 coding downstream 146309 37815894 ~ 37821863 (-)
AMCG00020948 gfpt1,LOC103362312,LOC108426669,LOC102792631 coding downstream 153275 37772151 ~ 37814897 (-)
AMCG00020940 NA coding downstream 402052 37556580 ~ 37566120 (-)
AMCG00020938 acty,actr1,LOC106585571,LOC105889177,LOC108425179 coding downstream 418267 37545624 ~ 37549905 (-)
AMCG00020952 NA coding upstream 64130 38095102 ~ 38095590 (-)
AMCG00020958 NA coding upstream 201694 38232666 ~ 38238994 (-)
AMCG00020957 NA coding upstream 210774 38241746 ~ 38260001 (-)
AMCG00020959 NA coding upstream 247663 38278635 ~ 38300419 (-)
AMCG00020961 NA coding upstream 335155 38366127 ~ 38410862 (-)
G66817 NA non-coding downstream 68294 37899467 ~ 37899878 (-)
G66786 NA non-coding downstream 228975 37736763 ~ 37739197 (-)
G66740 NA non-coding downstream 472802 37495123 ~ 37495370 (-)
G66685 NA non-coding downstream 699949 37267782 ~ 37268223 (-)
G66613 NA non-coding downstream 948376 37013981 ~ 37019796 (-)
G66851 NA non-coding upstream 150065 38181037 ~ 38181274 (-)
G66872 NA non-coding upstream 247022 38277994 ~ 38278539 (-)
G66920 NA non-coding upstream 664020 38694992 ~ 38697487 (-)
G66926 NA non-coding upstream 676300 38707272 ~ 38732240 (-)
G66927 NA non-coding upstream 693319 38724291 ~ 38772808 (-)
AMCG00020943 NA other downstream 335596 37631777 ~ 37632576 (-)
AMCG00020922 NA other downstream 900367 37061595 ~ 37067805 (-)
AMCG00020923 whsc1l1,LOC107720716,LOC107687514,LOC107705078 other downstream 922233 37020011 ~ 37045939 (-)
AMCG00020911 NA other downstream 1685643 36260993 ~ 36282529 (-)
AMCG00020900 NA other downstream 1981460 35975764 ~ 35986712 (-)
AMCG00020970 NA other upstream 1016732 39047704 ~ 39104867 (-)
AMCG00020997 atad1a,LOC106580455,LOC105890049,LOC105014378,LOC107656802,LOC108414574 other upstream 2526158 40557130 ~ 40640339 (-)
AMCG00021012 NA other upstream 3565108 41596080 ~ 41602270 (-)

Expression


Co-expression Network