AMCG00020967 (LOC108444561,LOC104924995,LOC105889889)


Basic Information

Item Value
gene id AMCG00020967
gene name LOC108444561,LOC104924995,LOC105889889
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 38880596 ~ 38885107 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020967
ATGAACACAACAATGGGAACGCAGCAGCCCAATGGTACCTTCCTGCCTTACTATCTCCACTCCACTTCAGTGGCTGCCAGCTACATTGTGTCCTACTTCTTCATCTTCGTGCTGTGCATGGTGGGGAATGGGCTGGTGTGCTTCGTGGTCCTCCGTAACCGGAGGATGCGCACCGTCACCAACCTCTTCATACTCAACCTGGCCATCAGTGACCTGCTGGTGGGCATCTTCTGTGTGCCAACAACTCTGGTGGACAATCTCATTACAGGCTGGCCATTCAGCCAGTTCATGTGCACCATGAGCGGACTGATCCAGGGGATGTCTGTCTCTGCATCTGTCTTCACCCTTGTGGCCATCGCTGTGGACAGGTAG

Function

NR:

description
PREDICTED: neuropeptide FF receptor 1-like

GO:

id name namespace
GO:0007218 neuropeptide signaling pathway biological_process
GO:0016021 integral component of membrane cellular_component
GO:0008188 neuropeptide receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020967 True 372 mRNA 0.54 2 38880596 38885107

Neighbor

gene id symbol gene type direction distance location
AMCG00020965 NA coding upstream 68342 38784879 ~ 38812254 (+)
AMCG00020964 NA coding upstream 107781 38756735 ~ 38772815 (+)
AMCG00020963 egr3,LOC106579855,LOC106585589 coding upstream 186091 38688163 ~ 38694505 (+)
AMCG00020962 rhobtb2,LOC106585588 coding upstream 364254 38491712 ~ 38516342 (+)
AMCG00020956 NA coding upstream 605441 38259518 ~ 38275155 (+)
AMCG00020966 NA coding downstream 13838 38898945 ~ 38901605 (+)
AMCG00020968 LOC106579847,LOC108236587,LOC105014870 coding downstream 68378 38953485 ~ 38972284 (+)
AMCG00020969 bmp1,LOC103470513,LOC103145852 coding downstream 99770 38984877 ~ 39004829 (+)
AMCG00020972 atp6v1b2,LOC108277294,LOC106563054,LOC103034689,LOC105890663 coding downstream 127604 39012711 ~ 39027527 (+)
AMCG00020973 NA coding downstream 162153 39047260 ~ 39061811 (+)
G66887 NA non-coding upstream 455344 38424712 ~ 38425252 (+)
G66865 NA non-coding upstream 604302 38275990 ~ 38276294 (+)
G66861 NA non-coding upstream 636121 38240690 ~ 38244475 (+)
G66826 NA non-coding upstream 814931 37974803 ~ 38065665 (+)
G66801 NA non-coding upstream 1018264 37837102 ~ 37862332 (+)
G66970 NA non-coding downstream 125472 39010579 ~ 39010849 (+)
G66995 NA non-coding downstream 164314 39049421 ~ 39049631 (+)
G67027 NA non-coding downstream 420190 39305297 ~ 39305587 (+)
G67048 NA non-coding downstream 864050 39749157 ~ 39749361 (+)
G67180 NA non-coding downstream 1685220 40570327 ~ 40571722 (+)
AMCG00020954 NA other upstream 743523 38117062 ~ 38137073 (+)
AMCG00020942 NA other upstream 1304740 37567036 ~ 37575856 (+)
G66551 NA other upstream 1963160 36914815 ~ 36917436 (+)
G66506 NA other upstream 2624085 36254699 ~ 36256511 (+)
G66362 NA other upstream 2972194 35867393 ~ 35908402 (+)
G67108 LOC100846954 other downstream 1436006 40321113 ~ 40321821 (+)
AMCG00020993 atad1,atad1a,LOC105014378,LOC108414574,LOC106580455,LOC103365845,LOC107087860,LOC102796919,LOC101479261,LOC100705680,LOC106527948,LOC105919473 other downstream 1670859 40555966 ~ 40570215 (+)
AMCG00021005 LOC106580519 other downstream 2166365 41051472 ~ 41062527 (+)
G67323 NA other downstream 2713116 41598223 ~ 41602113 (+)
G67459 NA other downstream 3167823 42052930 ~ 42053675 (+)

Expression


Co-expression Network