AMCG00021024


Basic Information

Item Value
gene id AMCG00021024
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 42122817 ~ 42125001 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021024
GGATGCTTCCTAGCCCCATGACGTCCACACCTTTCTCTGTTAAGGACATCCTGAAGCTGGAGCAACAGCACTCCAACAATTTTTTCCACCAACAAGGATTTCTAGTCCAAGAACTGGATGCTTCTTCCATGCAAACGCCACAATATATGCACATCGGACATAAAAGCTCCGACATGCTGTACAGTCCGGACAAGCTGTCCTGTGCTGTCGGGGAGCCAGTGAAACGCCATATTAACTCGGACGAGTTTGATATTGTTAGCGGCTCATGTAGCTCCCCGACACAGGAGGAAATCGACCCAATCGAGGACCCAGACAAGTCGCTGGAGTTAGTCGGGCACCCGCCTCCACCAAGAAGGGTAGCCGTTCCGGTGTTAGTTCGTGATGGGAAACCCTGCCTTGGAGGATCCCAAACGTACACAGCCCCTTACAATGTAACCGTAAGCCCTTACCCATACAATACATACTACAGTGGCTATGGCAACAGCCCATATAGTTGCACTTACGCAGGGGTGTCCCCGGTGCCAACTTCTACACAACCCGCCAGTCATATCGTCAACATGAATATCACTATGGGCGGCGTGGGACAGCAGGGTCCCTTGACTCAACAAAGCCATCTACAGGCCACGCTGCAAGGAATCAGAGCGTGG

Function

GO:

id name namespace
GO:0055007 cardiac muscle cell differentiation biological_process
GO:0060038 cardiac muscle cell proliferation biological_process
GO:0001947 heart looping biological_process
GO:1901210 regulation of cardiac chamber formation biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021024 True 647 mRNA 0.52 2 42122817 42125001

Neighbor

gene id symbol gene type direction distance location
AMCG00021025 NA coding upstream 31161 42062717 ~ 42091656 (+)
AMCG00021023 NA coding upstream 107663 41983383 ~ 42015154 (+)
AMCG00021019 NA coding upstream 188072 41894833 ~ 41934745 (+)
AMCG00021017 LOC106585609 coding upstream 260939 41841031 ~ 41861878 (+)
AMCG00021018 gpat4,LOC102786815,LOC106585610 coding upstream 339970 41755505 ~ 41782847 (+)
AMCG00021034 NA coding downstream 500383 42625384 ~ 42919615 (+)
G67405 NA non-coding upstream 137786 41984611 ~ 41985031 (+)
G67398 NA non-coding upstream 228838 41890671 ~ 41893979 (+)
G67393 NA non-coding upstream 268148 41737247 ~ 41854669 (+)
G67371 NA non-coding upstream 503208 41619295 ~ 41619609 (+)
G67322 NA non-coding upstream 614716 41507607 ~ 41508101 (+)
G67479 NA non-coding downstream 24558 42149559 ~ 42149967 (+)
G67519 NA non-coding downstream 270724 42395725 ~ 42395996 (+)
G67521 NA non-coding downstream 278820 42403821 ~ 42404266 (+)
G67528 NA non-coding downstream 348657 42473658 ~ 42473885 (+)
G67533 NA non-coding downstream 358527 42483528 ~ 42483927 (+)
G67459 NA other upstream 69142 42052930 ~ 42053675 (+)
G67323 NA other upstream 520704 41598223 ~ 41602113 (+)
AMCG00021005 LOC106580519 other upstream 1060290 41051472 ~ 41062527 (+)
AMCG00020993 atad1,atad1a,LOC105014378,LOC108414574,LOC106580455,LOC103365845,LOC107087860,LOC102796919,LOC101479261,LOC100705680,LOC106527948,LOC105919473 other upstream 1552602 40555966 ~ 40570215 (+)
G67108 LOC100846954 other upstream 1800996 40321113 ~ 40321821 (+)
AMCG00021029 sfrp1,LOC104937559,LOC106585130,LOC105889956 other downstream 298342 42423343 ~ 42465886 (+)

Expression


Co-expression Network