AMCG00021032 (slc25a37,LOC107093885)


Basic Information

Item Value
gene id AMCG00021032
gene name slc25a37,LOC107093885
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 42245997 ~ 42269261 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021032
ATGGAGTTGCGCACCGACCCTGTCGCAGCCGCCTTGGAGATGTCGGAGAGCAGCGAAAGCCGAGACGTGGAGACCTCCGAGGGCGATGACTACGAGAGCTTGCCGCCCACCGCCTCCCTGGCGACGCACATGACAGCCGGAGCCGTGGCAGGGATCCTGGAGCACACAGTGATGTACCCCGTGGACTCCGTCAAGACACGGATGCAGAGCTTACAGCCAGATCCTCAGGCTCAGTACCGCGGTGTGTATGAGGCTCTGCGCAGGATTGTGCGTACTGAAGGCTTGCTGCGGCCCCTGCGAGGACTCAATGTCACCATGCTGGGCGCTGGGCCGGCCCACGCCCTCTACTTCGCCTGCTACGAGAGAGTCAAGCACACACTGAGCGACTCAATGCCAATCTTGTAA

Function

symbol description
slc25a37 Enables iron ion transmembrane transporter activity. Acts upstream of or within embryonic hemopoiesis; erythrocyte maturation; and iron import into the mitochondrion. Located in mitochondrion. Is expressed in blood island; intermediate cell mass of mesoderm; and lateral plate mesoderm. Orthologous to human SLC25A37 (solute carrier family 25 member 37).

NR:

description
PREDICTED: mitoferrin-1

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021032 True 405 mRNA 0.62 3 42245997 42269261

Neighbor

gene id symbol gene type direction distance location
AMCG00021031 slc25a37,LOC107393770,LOC103371456,LOC106585578 coding downstream 7619 42237241 ~ 42238378 (-)
AMCG00021028 NA coding downstream 128099 42000649 ~ 42117898 (-)
AMCG00021027 NA coding downstream 270836 41974859 ~ 41975161 (-)
AMCG00021026 LOC108425180,LOC103036397,LOC106567972,LOC105015192 coding downstream 558294 41673609 ~ 41687703 (-)
AMCG00021008 NA coding downstream 878640 41366724 ~ 41367357 (-)
AMCG00021030 NA coding upstream 33665 42302926 ~ 42315442 (-)
AMCG00021033 golga7,LOC106585131,LOC104937560 coding upstream 52846 42322107 ~ 42350197 (-)
G67480 NA non-coding downstream 96031 42149593 ~ 42149966 (-)
G67462 NA non-coding downstream 170243 42075323 ~ 42075754 (-)
G67440 NA non-coding downstream 352013 41891038 ~ 41893984 (-)
G67368 NA non-coding downstream 653268 41592521 ~ 41592729 (-)
G67360 NA non-coding downstream 675706 41550415 ~ 41570291 (-)
G67522 NA non-coding upstream 134560 42403821 ~ 42404270 (-)
G67534 NA non-coding upstream 214324 42483585 ~ 42484218 (-)
G67537 NA non-coding upstream 316566 42585827 ~ 42586109 (-)
G67565 NA non-coding upstream 622875 42892136 ~ 42892423 (-)
AMCG00021012 NA other downstream 643727 41596080 ~ 41602270 (-)
AMCG00020997 atad1a,LOC106580455,LOC105890049,LOC105014378,LOC107656802,LOC108414574 other downstream 1605658 40557130 ~ 40640339 (-)
AMCG00020970 NA other downstream 3141130 39047704 ~ 39104867 (-)
AMCG00020943 NA other downstream 4613421 37631777 ~ 37632576 (-)
AMCG00020922 NA other downstream 5178192 37061595 ~ 37067805 (-)

Expression


Co-expression Network