G59425



Basic Information


Item Value
gene id G59425
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 1796926 ~ 1797141 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU74302
ccaaattgtctcttcagccacatcgctggggagtttgttcagattgtgacgcctctctgtgtgaagaagtgtctcctgttttctgtcttgaatgccttgaagcccaatttccatttgtgtccccgggtgcgtgtgtccctgctgatctggaaaagctcctctggtttgatgtggtcgatgcctttcatgatgttgaagacttgaatcaagtcccca

Function


GO:

id name namespace
GO:0035556 intracellular signal transduction biological_process
GO:0046578 regulation of Ras protein signal transduction biological_process
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0007265 Ras protein signal transduction biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU74302 True 216 lncRNA 0.49 1 1796926 1797141

Neighbor


gene id symbol gene type direction distance location
AMCG00019886 LOC107374630,LOC108230875,LOC104924185,LOC105913012,LOC101063574 coding upstream 211304 1585023 ~ 1585622 (+)
AMCG00019885 NA coding upstream 668236 1124534 ~ 1128690 (+)
AMCG00019879 trim32,LOC107728008,LOC107564424 coding upstream 1221231 573758 ~ 575695 (+)
AMCG00019877 NA coding upstream 1378821 385026 ~ 418105 (+)
AMCG00019876 NA coding upstream 1499614 281341 ~ 297312 (+)
AMCG00019894 NA coding downstream 477238 2274379 ~ 2327335 (+)
AMCG00019893 lhx3 coding downstream 543647 2340788 ~ 2351023 (+)
AMCG00019898 cunh9orf69,c5h9orf69,lg14h9orf69,LOC106563262,LOC106565885 coding downstream 617723 2414864 ~ 2416601 (+)
AMCG00019896 NA coding downstream 646110 2443251 ~ 2454771 (+)
AMCG00019897 NA coding downstream 684764 2481905 ~ 2483959 (+)
G59411 NA non-coding upstream 187553 1609017 ~ 1609373 (+)
G59402 NA non-coding upstream 303037 1493685 ~ 1493889 (+)
G59387 NA non-coding upstream 532187 1264492 ~ 1264739 (+)
G59385 NA non-coding upstream 567721 1228946 ~ 1229205 (+)
G59381 NA non-coding upstream 610692 1185283 ~ 1186234 (+)
G59440 NA non-coding downstream 237420 2034561 ~ 2034794 (+)
G59459 NA non-coding downstream 364794 2161935 ~ 2163604 (+)
G59460 NA non-coding downstream 367380 2164521 ~ 2167440 (+)
G59467 NA non-coding downstream 383462 2180603 ~ 2181069 (+)
G59557 NA non-coding downstream 786553 2583694 ~ 2634130 (+)
AMCG00019884 NA other upstream 687930 1074816 ~ 1108996 (+)
G59305 NA other upstream 1351396 441598 ~ 445530 (+)
AMCG00019920 NA other downstream 1165367 2962508 ~ 2969595 (+)
AMCG00019934 NA other downstream 1444167 3241308 ~ 3251407 (+)
AMCG00019967 prrc2b other downstream 3026672 4823813 ~ 4856929 (+)
G60137 NA other downstream 3558631 5355772 ~ 5361863 (+)
G60132 NA other downstream 3561323 5358464 ~ 5359365 (+)

Expression



Co-expression Network