G59484



Basic Information


Item Value
gene id G59484
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 2192334 ~ 2192547 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU74365
caaattgtctcttcagccacatcgctggggagtttgttcagattgtgacgcctctctgtgtgaagaagtgtctcctgttttctgtcttgaatgccttgaagcccaatttccatgtgtgtccccgggtgcgtgtgtccctgctgatctggaaaagctcctctggtttgatgtggtcgatgcctttcatgattttgaagacttggatcaagtcccc

Function


GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU74365 True 214 lncRNA 0.49 1 2192334 2192547

Neighbor


gene id symbol gene type direction distance location
AMCG00019890 LOC107731024,LOC108423692,LOC107665022,LOC108255392,LOC107595531 coding downstream 7139 2160178 ~ 2185195 (-)
AMCG00019889 NA coding downstream 56395 2105830 ~ 2135939 (-)
AMCG00019888 brinp1,LOC107597955,LOC106563266 coding downstream 271579 1913441 ~ 1920755 (-)
AMCG00019887 brinp1 coding downstream 302465 1874560 ~ 1889869 (-)
AMCG00019883 NA coding downstream 1246445 944898 ~ 945889 (-)
AMCG00019891 gpsm1,LOC106910217 coding upstream 19130 2211677 ~ 2212773 (-)
AMCG00019892 gpsm1,LOC106563264 coding upstream 34257 2226804 ~ 2247160 (-)
AMCG00019899 NA coding upstream 271089 2463636 ~ 2479709 (-)
AMCG00019913 NA coding upstream 497355 2689902 ~ 2690317 (-)
AMCG00019914 NA coding upstream 512782 2705329 ~ 2705778 (-)
G59414 NA non-coding downstream 530155 1605102 ~ 1662179 (-)
G59403 NA non-coding downstream 698361 1493686 ~ 1493973 (-)
G59396 NA non-coding downstream 795109 1389345 ~ 1397225 (-)
G59395 NA non-coding downstream 844855 1347246 ~ 1347479 (-)
G59390 NA non-coding downstream 907589 1284425 ~ 1284745 (-)
G59485 NA non-coding upstream 3256 2195803 ~ 2221194 (-)
G59556 NA non-coding upstream 382257 2574804 ~ 2575670 (-)
G59810 NA non-coding upstream 1298171 3490718 ~ 3491049 (-)
G59825 ttll11,LOC107579646 non-coding upstream 1404658 3597205 ~ 3597760 (-)
G59827 NA non-coding upstream 1447491 3640038 ~ 3642114 (-)
G59408 LOC107374630,LOC108230875,LOC104924185,LOC105913012,LOC101063574 other downstream 606334 1584919 ~ 1586000 (-)
AMCG00019880 NA other downstream 1619507 535831 ~ 572827 (-)
G59505 NA other upstream 131741 2324288 ~ 2327415 (-)
G59530 NA other upstream 262364 2454911 ~ 2480799 (-)
G59545 NA other upstream 302352 2494899 ~ 2507020 (-)
G59712 NA other upstream 839309 3031856 ~ 3034335 (-)
G59720 NA other upstream 915254 3107801 ~ 3111347 (-)

Expression



Co-expression Network