G60516



Basic Information


Item Value
gene id G60516
gene name NA
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 7440803 ~ 7562592 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU75693
gagcatcagaactggaccatggagcaatggaagaaggtggcctggtctgatgaatcacgagttcaaggtgttgacttggcctccaaattccccagatctcaatccaatcgagcatctgtgggatgtgctggacaaacaagtccgatccatggaggccccacctcgcaacttacaggatttaaaggatctgctgctaacgacttggtgccagataccacagcacaccctcagaggtctagtggagtccatgcctcgacgggtcagggctgttttggcggcaaaagggggacctacacaatattaggcaggtggtcacaatgttatggctgatcagtgta

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA


RNA id representative length rna type GC content exon number start site end site
TU75693 True 338 TUCP 0.52 2 7440803 7562592

Neighbor


gene id symbol gene type direction distance location
AMCG00020035 NA coding downstream 55041 7364054 ~ 7385762 (-)
AMCG00020027 lhx2,lhx2b coding downstream 314180 7112813 ~ 7126623 (-)
AMCG00020026 NA coding downstream 432747 6986536 ~ 7008056 (-)
AMCG00020025 NA coding downstream 517330 6898884 ~ 6923473 (-)
AMCG00020024 NA coding downstream 543814 6869573 ~ 6896989 (-)
AMCG00020043 nup188,LOC102792001 coding upstream 204333 7766925 ~ 7785992 (-)
AMCG00020051 NA coding upstream 229706 7792298 ~ 7797939 (-)
AMCG00020050 lrrc8a,LOC104923672 coding upstream 237330 7799922 ~ 7810406 (-)
AMCG00020054 vav2 coding upstream 319228 7881820 ~ 7927867 (-)
AMCG00020055 NA coding upstream 491227 8053819 ~ 8071930 (-)
G60387 NA non-coding downstream 640053 6797909 ~ 6800750 (-)
G60377 NA non-coding downstream 745027 6679178 ~ 6695776 (-)
G60356 NA non-coding downstream 951426 6487309 ~ 6489377 (-)
G60345 NA non-coding downstream 996070 6443275 ~ 6444733 (-)
G60317 NA non-coding downstream 1081864 6300656 ~ 6358939 (-)
G60540 NA non-coding upstream 10005 7572597 ~ 7572831 (-)
G60610 NA non-coding upstream 290409 7853001 ~ 7854373 (-)
G60656 NA non-coding upstream 482017 8044609 ~ 8047241 (-)
G60723 NA non-coding upstream 1231376 8793968 ~ 8796315 (-)
G60725 NA non-coding upstream 1236372 8798964 ~ 8799167 (-)
AMCG00020019 NA other downstream 969369 6467271 ~ 6471434 (-)
G60348 NA other downstream 974217 6463548 ~ 6466586 (-)
AMCG00020017 arpc5l,arpc5la,LOC107571143,LOC107753090,LOC108411248 other downstream 979375 6450622 ~ 6461428 (-)
AMCG00020002 edf1,LOC106563255,LOC105015108,LOC100194632 other downstream 1268329 6159577 ~ 6172474 (-)
AMCG00019992 NA other downstream 2148130 5291590 ~ 5292673 (-)
AMCG00020066 fam69b,fa69b other upstream 1250193 8812785 ~ 8828109 (-)
G60746 NA other upstream 1276619 8839211 ~ 8839945 (-)
G61170 NA other upstream 3192876 10755468 ~ 10756419 (-)
G61269 NA other upstream 4133099 11695691 ~ 11701645 (-)
AMCG00020159 NA other upstream 4439108 12001700 ~ 12052211 (-)

Expression



Co-expression Network