G62251 (chd9,LOC106562403)


Basic Information

Item Value
gene id G62251
gene name chd9,LOC106562403
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 15297747 ~ 15298181 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU77943
CTCCTTCTTCACCACTCGAGAGGACATGATTTTGTCCACCACAGCTGCGTCCTCCTCACTGGGGTTTTCCTGCACGAACAGCTGCACCGCCTGCTCCTTGCGTGAGCTGCCGGCCACTGTCTTCTTGGCCTTGACGATGACCTTCACCTCCTCGTCCGACACCTTGCTTTCCCCGTCCTCCGCATACTTTTTCCGCTTTACCTGCCGGTTGGATCTTCTCT

Function

symbol description
chd9 Predicted to enable several functions, including ATP binding activity; DNA binding activity; and DNA helicase activity. Predicted to be located in nucleus. Is expressed in female organism. Orthologous to human CHD9 (chromodomain helicase DNA binding protein 9).

NR:

description
PREDICTED: chromodomain-helicase-DNA-binding protein 9-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU77943 True 221 lncRNA 0.57 2 15297747 15298181

Neighbor

gene id symbol gene type direction distance location
AMCG00020299 NA coding upstream 50127 15245022 ~ 15247620 (+)
AMCG00020297 aktip,LOC107713059 coding upstream 52763 15235683 ~ 15244984 (+)
AMCG00020295 NA coding upstream 79717 15212090 ~ 15218030 (+)
AMCG00020296 NA coding upstream 98455 15166014 ~ 15199292 (+)
AMCG00020298 NA coding upstream 131753 15160597 ~ 15165994 (+)
AMCG00020304 LOC106562398 coding downstream 144730 15442911 ~ 15496323 (+)
AMCG00020306 sall1,LOC106587587 coding downstream 461904 15760085 ~ 15770745 (+)
AMCG00020305 sall3,LOC106562315,LOC108274520 coding downstream 472834 15771015 ~ 15778141 (+)
AMCG00020307 NA coding downstream 604331 15902512 ~ 15908316 (+)
AMCG00020311 NA coding downstream 705249 16003430 ~ 16011619 (+)
G62185 NA non-coding upstream 263664 15032042 ~ 15034083 (+)
G62108 NA non-coding upstream 676047 14554856 ~ 14621700 (+)
G62118 NA non-coding upstream 719045 14577507 ~ 14578702 (+)
G62114 NA non-coding upstream 730309 14566719 ~ 14567438 (+)
G62062 NA non-coding upstream 896445 14345296 ~ 14401302 (+)
G62275 NA non-coding downstream 35503 15333684 ~ 15335056 (+)
G62282 LOC107575789 non-coding downstream 125026 15423207 ~ 15423573 (+)
G62368 NA non-coding downstream 765914 16064095 ~ 16066816 (+)
G62398 NA non-coding downstream 800805 16098986 ~ 16100810 (+)
G62432 NA non-coding downstream 1117297 16415478 ~ 16488182 (+)
AMCG00020281 slc12a4 other upstream 825202 14467800 ~ 14472545 (+)
AMCG00020273 NA other upstream 1065479 14195784 ~ 14232268 (+)
AMCG00020267 NA other upstream 1346700 13948426 ~ 13951047 (+)
AMCG00020241 cdc26,LOC107743800,LOC107691734,LOC107603191 other upstream 1412631 13882825 ~ 13885116 (+)
AMCG00020255 NA other upstream 1425102 13863477 ~ 13872645 (+)
AMCG00020331 st3gal2,LOC107686287,LOC106573711,LOC107672232 other downstream 1284705 16582886 ~ 16604658 (+)
G62632 NA other downstream 1516193 16814374 ~ 16815857 (+)
AMCG00020370 NA other downstream 2135461 17433642 ~ 17442711 (+)
AMCG00020371 nutf2 other downstream 2160963 17459144 ~ 17471869 (+)
G62895 NA other downstream 2630147 17928328 ~ 17928904 (+)

Expression


Co-expression Network