G62990 (kifc3,LOC107670565)


Basic Information

Item Value
gene id G62990
gene name kifc3,LOC107670565
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 18201844 ~ 18202070 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU78861
CACCATCATTAAAGTCTTGCTGTCTCCGCTGAGAGAGTCCTGCAGCAGGTAGGTGAGGCGGGAGTTTCTGAAGGGGATGTGCGCATGTTTGGAGCGCAGGGCGTAGATGACGTCGCCTAGTGCTGCCAGGGACTTGTTGATGCACTGGGCCTCCCGCAACCGGCTGCCCTCTGCGCCCGACTTGGCAATTCGCTCCGAGCCTGCCAAGTCGACCAGATTCAGCTTCC

Function

symbol description
kifc3 Predicted to enable ATP binding activity; microtubule binding activity; and minus-end-directed microtubule motor activity. Predicted to act upstream of or within microtubule-based movement. Predicted to be located in microtubule. Orthologous to human KIFC3 (kinesin family member C3).

NR:

description
PREDICTED: kinesin-like protein KIFC3 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU78861 True 227 lncRNA 0.60 1 18201844 18202070

Neighbor

gene id symbol gene type direction distance location
AMCG00020413 LOC107596504,LOC108411466,LOC107753522 coding upstream 6214 18187199 ~ 18195630 (+)
AMCG00020412 LOC107707912 coding upstream 15796 18182076 ~ 18186048 (+)
AMCG00020405 elmo3,LOC106561448,LOC105018213,LOC107732817,LOC107665726 coding upstream 23724 18138887 ~ 18178120 (+)
AMCG00020406 e2f4,LOC106573204 coding upstream 67032 18119713 ~ 18134812 (+)
AMCG00020395 cnot1 coding upstream 221293 17956708 ~ 17980551 (+)
AMCG00020415 NA coding downstream 136367 18338437 ~ 18358845 (+)
AMCG00020420 NA coding downstream 180073 18382143 ~ 18389911 (+)
AMCG00020419 NA coding downstream 193787 18395857 ~ 18398731 (+)
AMCG00020425 ccdc102a,LOC106562045,LOC107594240,LOC107081377,LOC103376291 coding downstream 308393 18510463 ~ 18522856 (+)
AMCG00020426 ccdc102a,LOC106587147,LOC106562045,LOC107674431,LOC107754670 coding downstream 328108 18530178 ~ 18536093 (+)
G62989 NA non-coding upstream 1036 18197579 ~ 18200808 (+)
G62975 NA non-coding upstream 63577 18134993 ~ 18138267 (+)
G62916 NA non-coding upstream 169705 17987848 ~ 18032139 (+)
G62912 NA non-coding upstream 218323 17981033 ~ 17983521 (+)
G62909 NA non-coding upstream 246570 17954323 ~ 17955274 (+)
G62991 NA non-coding downstream 2890 18204960 ~ 18205970 (+)
G62992 NA non-coding downstream 6341 18208411 ~ 18208650 (+)
G62993 NA non-coding downstream 8068 18210138 ~ 18210377 (+)
G62994 NA non-coding downstream 8699 18210769 ~ 18211029 (+)
G63058 NA non-coding downstream 158205 18360275 ~ 18360493 (+)
AMCG00020407 NA other upstream 129793 18067787 ~ 18072051 (+)
AMCG00020408 NA other upstream 136055 18058558 ~ 18065789 (+)
G62895 NA other upstream 272940 17928328 ~ 17928904 (+)
AMCG00020371 nutf2 other upstream 729975 17459144 ~ 17471869 (+)
AMCG00020370 NA other upstream 759133 17433642 ~ 17442711 (+)
G63045 NA other downstream 130499 18332569 ~ 18334032 (+)
AMCG00020439 LOC107696663,LOC107556242,LOC107746488,LOC107726063 other downstream 1395133 19597203 ~ 19602324 (+)
AMCG00020438 NA other downstream 1429255 19631325 ~ 19636221 (+)
AMCG00020470 NA other downstream 3933298 22135368 ~ 22142198 (+)
AMCG00020487 NA other downstream 4154104 22356174 ~ 22409493 (+)

Expression


Co-expression Network