G66739


Basic Information

Item Value
gene id G66739
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 37495121 ~ 37495381 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU83422
ctacagtagctcgtctgttggatcggaccacacgggccagccttcgctccccacgtgcatcagtgagccttggccgcccatgaccctgtcgccggttcaccgcttttccttccttggacacttttgataggtactgagcactgcagaccgggaacaccccacaagagctgcagttttggagatgctctgacccagtcgtctagccatcgcaatttggcccttgtcaaagtcgctcagatccttacgctgcccatttttcct

Function

GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU83422 True 261 lncRNA 0.56 1 37495121 37495381

Neighbor

gene id symbol gene type direction distance location
AMCG00020931 loxl2,LOC106580522 coding upstream 268252 37203988 ~ 37226869 (+)
AMCG00020930 LOC106580522,LOC104937675,LOC107673422 coding upstream 309193 37183664 ~ 37185928 (+)
AMCG00020926 NA coding upstream 329819 37158652 ~ 37165302 (+)
AMCG00020925 NA coding upstream 383031 37094286 ~ 37112090 (+)
AMCG00020919 NA coding upstream 437085 37047642 ~ 37058036 (+)
AMCG00020941 NA coding downstream 133943 37629324 ~ 37630094 (+)
AMCG00020945 antxr1,LOC108236442,LOC103362313 coding downstream 174581 37669962 ~ 37685496 (+)
AMCG00020944 antxr1a,antxrl,LOC107553121,LOC107661337,LOC107562635,LOC106585598 coding downstream 217618 37712999 ~ 37717080 (+)
AMCG00020946 anxa4,LOC107583400,LOC107758674,LOC107689041,LOC107558128 coding downstream 410890 37906271 ~ 37922454 (+)
AMCG00020951 NA coding downstream 535347 38030728 ~ 38031966 (+)
G66701 NA non-coding upstream 185786 37304049 ~ 37309335 (+)
G66700 NA non-coding upstream 193523 37301248 ~ 37301598 (+)
G66696 NA non-coding upstream 206280 37288514 ~ 37288841 (+)
G66602 NA non-coding upstream 420487 37073679 ~ 37074634 (+)
G66528 NA non-coding upstream 688544 36806320 ~ 36806577 (+)
G66780 NA non-coding downstream 155048 37650429 ~ 37650698 (+)
G66784 NA non-coding downstream 242351 37737732 ~ 37739188 (+)
G66801 NA non-coding downstream 341721 37837102 ~ 37862332 (+)
G66826 NA non-coding downstream 479422 37974803 ~ 38065665 (+)
G66861 NA non-coding downstream 745309 38240690 ~ 38244475 (+)
G66551 NA other upstream 577685 36914815 ~ 36917436 (+)
G66506 NA other upstream 1238610 36254699 ~ 36256511 (+)
G66362 NA other upstream 1586719 35867393 ~ 35908402 (+)
AMCG00020874 NA other upstream 1744675 35747156 ~ 35750446 (+)
G66149 NA other upstream 2330136 35163813 ~ 35164985 (+)
AMCG00020942 NA other downstream 71655 37567036 ~ 37575856 (+)
AMCG00020954 NA other downstream 621681 38117062 ~ 38137073 (+)
G67108 LOC100846954 other downstream 2825732 40321113 ~ 40321821 (+)
AMCG00020993 atad1,atad1a,LOC105014378,LOC108414574,LOC106580455,LOC103365845,LOC107087860,LOC102796919,LOC101479261,LOC100705680,LOC106527948,LOC105919473 other downstream 3060585 40555966 ~ 40570215 (+)
AMCG00021005 LOC106580519 other downstream 3556091 41051472 ~ 41062527 (+)

Expression


Co-expression Network