AMCG00021371 (rap2c,LOC100691801,LOC106515678,LOC107751959,LOC106676304)


Basic Information

Item Value
gene id AMCG00021371
gene name rap2c,LOC100691801,LOC106515678,LOC107751959,LOC106676304
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 15890880 ~ 15891146 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021371
ATGCGAGACCAGATCGTCCGTGTGAAGCGTTACGAGAAGGTGCCGCTTATTCTCGTGGGCAACAAGGTGGACCTGGAGTCAGAGCGCGAGGTGTCGGGGGCGGACGGGCGTGCCCTGGCCCAGGAGTGGGGCTGCCCCTTCATGGAGACGTCAGCCAAGAGCAAGACCATGGTGGATGAGCTGTTTGCCGAGATTGTGAGGCAGATGAACTACTCCGCGCTGCCCGAGAAGCAGGACCAGTGCTGCACCACCTGCGTCGTCCAGTGA

Function

symbol description
rap2c Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Predicted to be involved in Rap protein signal transduction and negative regulation of cell migration. Predicted to act upstream of or within signal transduction. Predicted to be located in recycling endosome membrane. Predicted to be active in plasma membrane. Orthologous to human RAP2C (RAP2C, member of RAS oncogene family).

NR:

description
PREDICTED: ras-related protein Rap-2c

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:0016020 membrane cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function

KEGG:

id description
K07839 RAP2C; Ras-related protein Rap-2C

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021371 True 267 mRNA 0.62 1 15890880 15891146

Neighbor

gene id symbol gene type direction distance location
AMCG00021362 mbnl3,LOC107560839,LOC107661388,LOC107658075,LOC107751960,LOC107707252,LOC108444474 coding upstream 37222 15836526 ~ 15853658 (+)
AMCG00021363 NA coding upstream 56439 15827604 ~ 15834441 (+)
AMCG00021365 LOC101469993,LOC103374067,LOC102309869 coding upstream 98731 15790737 ~ 15792149 (+)
AMCG00021366 NA coding upstream 105909 15779989 ~ 15784971 (+)
AMCG00021361 LOC106586057,LOC106612107,LOC105026369 coding upstream 138710 15740735 ~ 15752170 (+)
AMCG00021369 NA coding downstream 7011 15898157 ~ 15909556 (+)
AMCG00021368 NA coding downstream 36514 15927660 ~ 15931593 (+)
AMCG00021367 NA coding downstream 44290 15935436 ~ 15939300 (+)
AMCG00021370 LOC107752047 coding downstream 89935 15981081 ~ 15987612 (+)
AMCG00021374 snx12,LOC107673821,LOC107733510,LOC107557076 coding downstream 120048 16011194 ~ 16016920 (+)
G85507 NA non-coding upstream 135448 15753082 ~ 15755432 (+)
G85497 NA non-coding upstream 314362 15575549 ~ 15576518 (+)
G85426 ddx26b,ints6l,LOC107658008 non-coding upstream 324054 15446311 ~ 15566826 (+)
G85552 NA non-coding downstream 29593 15920739 ~ 15922721 (+)
G85623 NA non-coding downstream 249377 16140523 ~ 16169886 (+)
G85674 NA non-coding downstream 398603 16289749 ~ 16292193 (+)
G85746 NA non-coding downstream 656511 16547657 ~ 16549345 (+)
G85757 NA non-coding downstream 678301 16569447 ~ 16569650 (+)
AMCG00021349 mmgt1,tmm32,LOC107658091,LOC107560676,LOC102787804 other upstream 458516 15428477 ~ 15432364 (+)
AMCG00021292 NA other upstream 1817755 14069330 ~ 14073125 (+)
AMCG00021296 NA other upstream 1857323 14016133 ~ 14033557 (+)
AMCG00021267 timm8a,LOC107593201 other upstream 2453472 13435307 ~ 13437408 (+)
G84749 NA other upstream 3790173 12075345 ~ 12100707 (+)
AMCG00021373 ubl3b,LOC107658069,LOC107707244,LOC108432919,LOC101472018,LOC107092570,LOC105029324,LOC100692344,LOC103390851 other downstream 172353 16063499 ~ 16073621 (+)
G85764 LOC103366846,LOC106930986 other downstream 699035 16590181 ~ 16592973 (+)
G85787 NA other downstream 765498 16656644 ~ 16714038 (+)
G85869 NA other downstream 1106731 16997877 ~ 17004131 (+)
AMCG00021441 NA other downstream 1579179 17470325 ~ 17473396 (+)

Expression


Co-expression Network