AMCG00021403


Basic Information

Item Value
gene id AMCG00021403
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 16573928 ~ 16579544 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021403
GGCAACAAGCATGGCAACCGGGGAGGCAGAAAAGAGACCTGTGCTGGAAGTGCGTGCTTCCCTGTGACCACTGTCCTCCCGTGTCTTCTGCAGGTCCAGGCCGAGGGTGATGACAACTCCTGTGTCACCTTCGTCCTGCATGAAGAAGACCACACCCTGGGCAACGCACTCAGATACATGGTCATGAAGAAACAGCAGTGGCCCGACACGATGGGAGTCAAAGACTCGGAATTAAAATTCGGAACTACGCTGCAGGGTCGTGACACCTACAAAGGTCAACTCGCATCAAAGCAGAATTCCAGTGACAACACTTGCGTGAGCCATATATTTGCTGTGTCCTCAGGGGGGCTGCCGGCAGTGGATCCATTTCGCCACGGCCTCAACGAGCTGACTGAGGTCTGCCAGCACATCCTGCACACTTTCGAGGTAAATCTCCCTGCTCTCTCACCCAGGACCCCCACTCCCTGCCTCTGCAGCTGGGGGCCCTTGCTCTCTATGTGCCCCCACCACACCTGCCCAGTCCCCAGGGGCCCTGCTGTCTGTCAGGGTTATGTTGGGGTTCCCAAGTAG

Function

GO: NA

KEGG:

id description
K03020 RPC19, POLR1D; DNA-directed RNA polymerases I and III subunit RPAC2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021403 True 570 mRNA 0.57 4 16573928 16579544

Neighbor

gene id symbol gene type direction distance location
AMCG00021401 NA coding upstream 12152 16556598 ~ 16561776 (+)
AMCG00021399 nup62,LOC100135786,LOC106603332 coding upstream 18283 16550033 ~ 16555645 (+)
AMCG00021400 cnga2,LOC103395327 coding upstream 28429 16541957 ~ 16545499 (+)
AMCG00021402 NA coding upstream 38112 16531948 ~ 16535816 (+)
AMCG00021398 NA coding upstream 46733 16526063 ~ 16527195 (+)
AMCG00021407 LOC105927798,LOC100704732,LOC103366304,LOC102229095,LOC107386560,LOC101162152,LOC101061287 coding downstream 56811 16636355 ~ 16642487 (+)
AMCG00021408 NA coding downstream 73896 16653440 ~ 16655886 (+)
AMCG00021415 NA coding downstream 175389 16754933 ~ 16756372 (+)
AMCG00021416 NA coding downstream 199038 16778582 ~ 16790852 (+)
AMCG00021417 NA coding downstream 218114 16797658 ~ 16806805 (+)
G85758 NA non-coding upstream 1060 16572193 ~ 16572868 (+)
G85757 NA non-coding upstream 4278 16569447 ~ 16569650 (+)
G85746 NA non-coding upstream 24583 16547657 ~ 16549345 (+)
G85674 NA non-coding upstream 281735 16289749 ~ 16292193 (+)
G85623 NA non-coding upstream 404042 16140523 ~ 16169886 (+)
G85760 NA non-coding downstream 4773 16584317 ~ 16584765 (+)
G85763 LOC105929187 non-coding downstream 6773 16586317 ~ 16589411 (+)
G85766 NA non-coding downstream 16657 16596201 ~ 16596902 (+)
G85784 NA non-coding downstream 67595 16647139 ~ 16649848 (+)
G85823 NA non-coding downstream 228262 16807806 ~ 16809314 (+)
AMCG00021373 ubl3b,LOC107658069,LOC107707244,LOC108432919,LOC101472018,LOC107092570,LOC105029324,LOC100692344,LOC103390851 other upstream 500307 16063499 ~ 16073621 (+)
AMCG00021349 mmgt1,tmm32,LOC107658091,LOC107560676,LOC102787804 other upstream 1141564 15428477 ~ 15432364 (+)
AMCG00021292 NA other upstream 2500803 14069330 ~ 14073125 (+)
AMCG00021296 NA other upstream 2540371 14016133 ~ 14033557 (+)
AMCG00021267 timm8a,LOC107593201 other upstream 3136520 13435307 ~ 13437408 (+)
G85764 LOC103366846,LOC106930986 other downstream 10637 16590181 ~ 16592973 (+)
G85787 NA other downstream 77100 16656644 ~ 16714038 (+)
G85869 NA other downstream 418333 16997877 ~ 17004131 (+)
AMCG00021441 NA other downstream 890781 17470325 ~ 17473396 (+)
G86121 NA other downstream 1668946 18248490 ~ 18249686 (+)

Expression


Co-expression Network