AMCG00021530 (vps50)


Basic Information

Item Value
gene id AMCG00021530
gene name vps50
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 20532168 ~ 20550930 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021530
ATGTGCTCCTCTCACTTGGACGCGCACATCACTCCGGACAGCTACATCCCCTGCCTGACGGACCTGTGCAAGGCCCTGTGGGAAGTCATGCTCAGCTACCATCGCACGATCGAGTGGCACGAGGAGCGCGATCACGAGGAGCCCTCGCCTGCGCCAGATGGGAACAGCGTGGCGGGGGCCGAGGAGCCGGACTTCGACCGCGGCTACGTGAAGCAGAAGCTCGAACACGGACTGCGGCGCATCTGGCAGGACGTCCAGCTGAAAGTCAAGGCCTACTTGCTCGGGACAGATATGTCAAACTTCAAATACGATGACTTCATCCTGGTGCTGGATATTATCAGCAGGCTCATGCAGGTGGGGGAGGAGTTCTGTGGCAGCAAGTCGGAGGTGCTGCAGGAGTCCATCAAGAGGCAGAGCGTCAACTACTTCAAGAATTACCACAGGTGA

Function

symbol description
vps50 Predicted to enable SNARE binding activity. Predicted to be involved in endocytic recycling. Predicted to act upstream of or within retrograde transport, endosome to Golgi. Predicted to be part of EARP complex. Is expressed in head and heart. Orthologous to human VPS50 (VPS50 subunit of EARP/GARPII complex).

NR:

description
PREDICTED: syndetin isoform X2

GO: NA

KEGG:

id description
K23288 VPS50; syndetin

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021530 True 447 mRNA 0.59 5 20532168 20550930

Neighbor

gene id symbol gene type direction distance location
AMCG00021527 vps50 coding upstream 7842 20506025 ~ 20524326 (+)
AMCG00021526 NA coding upstream 38994 20481211 ~ 20493174 (+)
AMCG00021522 NA coding upstream 138907 20389757 ~ 20393261 (+)
AMCG00021518 NA coding upstream 192430 20314180 ~ 20339738 (+)
AMCG00021513 NA coding upstream 257785 20214149 ~ 20274383 (+)
AMCG00021529 NA coding downstream 3563 20554493 ~ 20563626 (+)
AMCG00021528 vps50 coding downstream 26763 20577693 ~ 20589296 (+)
AMCG00021532 LOC103394147,LOC106952338,LOC107383304,LOC107085850 coding downstream 152174 20703104 ~ 20721264 (+)
AMCG00021535 NA coding downstream 183784 20734714 ~ 20782173 (+)
AMCG00021537 col1a2,LOC107722140,LOC107667770,LOC107591591,LOC107731699 coding downstream 246768 20797698 ~ 20827291 (+)
G86665 NA non-coding upstream 30865 20500786 ~ 20501303 (+)
G86633 NA non-coding upstream 69177 20462255 ~ 20462991 (+)
G86625 NA non-coding upstream 122510 20408404 ~ 20409658 (+)
G86573 NA non-coding upstream 233386 20298462 ~ 20298782 (+)
G86536 NA non-coding upstream 326630 20205192 ~ 20205538 (+)
G86685 NA non-coding downstream 61696 20612626 ~ 20614365 (+)
G86687 NA non-coding downstream 69576 20620506 ~ 20620721 (+)
G86695 LOC103362787 non-coding downstream 148284 20699214 ~ 20702457 (+)
G86727 NA non-coding downstream 350097 20901027 ~ 20902855 (+)
G86800 NA non-coding downstream 484172 21035102 ~ 21038425 (+)
G86601 NA other upstream 130919 20342610 ~ 20401249 (+)
G86616 NA other upstream 151744 20378423 ~ 20380424 (+)
AMCG00021517 gatad1 other upstream 160632 20368153 ~ 20371536 (+)
G86407 NA other upstream 1030926 19499800 ~ 19501242 (+)
AMCG00021485 NA other upstream 1237389 19279765 ~ 19294779 (+)
G86688 NA other downstream 116540 20667470 ~ 20667927 (+)
AMCG00021539 pdk4,LOC107722149 other downstream 357887 20908817 ~ 20912002 (+)
AMCG00021550 NA other downstream 547489 21098419 ~ 21109368 (+)
AMCG00021551 NA other downstream 607694 21158624 ~ 21165500 (+)
AMCG00021561 LOC106582151,LOC105891776,LOC106605261 other downstream 678922 21229852 ~ 21232853 (+)

Expression


Co-expression Network