AMCG00021644 (hoxa13b,LOC105018810)


Basic Information

Item Value
gene id AMCG00021644
gene name hoxa13b,LOC105018810
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 23756876 ~ 23758021 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021644
ATGACAGCGTCATTGCTTCTCCATCCCCGCTGGATTGACCCGGTGATGTTCCTCTACGACAACGGCTTAGATGAAGTGAACAAGAACATGGAAGGCTTTGCAGGAGGCAACTTTGCTGCGAATCAGTGTCGGAATCTGATGGCCCATCCTGCATCCCTGGCTCCCAGCACTGCCTACACGTCCAGTGAGGTGCCAGTGTCGGGCATGGCCGAGCCTGTCAAACAGTGCAGCCCCTGTTCTGCAGCCCAGAGCTCCTCCAGTGCGTCTCTGCCCTATGGATATTTTGGCAGTGGCTACTACCCCTGTAGGATGACCCATCACAGCAGCATTAAGTCCTGCGCGCAGCCTGCCTCCTATGCAGAGAAGTACATGGACACGTCGGGCTCAGGCGAAGACTTCACGTCCAGAGCAAAGGAATTTGCGTTTTATCAAGGCTATGCTGCTGGCCCCTATCAGCCCGTGCCCAGCTACTTGGACGTGCCAGTAGTCCCTGCTATTAGTGGCCCCGGGGAACCCAGGCATGAACCACTGTTGCCCATGGAGAGTTACCAGCCGTGGGCCATTACCAATGGGTGGAATGGTCAAGTTTACTGCTCGAAGGAGCAGAGCCAGCCGACACATCTGTGGAAATCAACCATTCAAGATGTCGTCTCACACCCAGGGGATGGCAACTCTTTTCGACGTGGGAGAAAGAAACGGGTGCCCTATACAAAG

Function

symbol description
hoxa13b Enables DNA-binding transcription factor activity, RNA polymerase II-specific. Acts upstream of or within fin development and negative regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Is expressed in several structures, including chondroblast; pectoral fin; pectoral fin bud; pectoral fin field; and tail bud. Human ortholog(s) of this gene implicated in Guttmacher syndrome and hand-foot-genital syndrome. Orthologous to human HOXA13 (homeobox A13).

NR:

description
homeobox protein Hox-A13b

GO:

id name namespace
GO:0007275 multicellular organism development biological_process
GO:0000122 negative regulation of transcription by RNA polymerase II biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021644 True 714 mRNA 0.55 2 23756876 23758021

Neighbor

gene id symbol gene type direction distance location
AMCG00021643 NA coding downstream 14322 23732442 ~ 23742554 (-)
AMCG00021642 NA coding downstream 29732 23724461 ~ 23727144 (-)
AMCG00021640 NA coding downstream 36776 23711509 ~ 23720100 (-)
AMCG00021641 NA coding downstream 46742 23709201 ~ 23710134 (-)
AMCG00021639 NA coding downstream 58047 23697644 ~ 23698829 (-)
AMCG00021647 hibadh,LOC107744697,LOC107596727,LOC107550829,LOC107685537,LOC107743154 coding upstream 55951 23813972 ~ 23824776 (-)
AMCG00021646 hibadh,LOC101062690,LOC106570522,LOC108441516 coding upstream 86650 23844671 ~ 23848491 (-)
AMCG00021649 jazf1,LOC108242006,LOC108441515,LOC107550831,LOC572950 coding upstream 127271 23885292 ~ 23892646 (-)
AMCG00021650 NA coding upstream 176463 23934484 ~ 23942615 (-)
AMCG00021653 NA coding upstream 294569 24052590 ~ 24054872 (-)
G87287 cbx3,LOC108425284,LOC105023664 non-coding downstream 268664 23482972 ~ 23488212 (-)
G87282 NA non-coding downstream 274976 23433216 ~ 23481900 (-)
G87269 NA non-coding downstream 384684 23371190 ~ 23372192 (-)
G87234 NA non-coding downstream 559033 23197581 ~ 23197843 (-)
G87218 NA non-coding downstream 650688 23093588 ~ 23106188 (-)
G87427 NA non-coding upstream 318878 24076899 ~ 24077107 (-)
G87428 LOC103376870 non-coding upstream 322715 24080736 ~ 24133311 (-)
G87495 NA non-coding upstream 520616 24278637 ~ 24279387 (-)
G87573 NA non-coding upstream 788061 24546082 ~ 24548123 (-)
G87627 NA non-coding upstream 1229421 24987442 ~ 24989739 (-)
AMCG00021634 NA other downstream 258115 23495025 ~ 23498761 (-)
G87263 NA other downstream 418392 23338251 ~ 23338484 (-)
AMCG00021630 NA other downstream 423908 23329325 ~ 23332968 (-)
AMCG00021619 NA other downstream 595885 23155187 ~ 23160991 (-)
AMCG00021569 NA other downstream 2085561 21666402 ~ 21671315 (-)
AMCG00021662 NA other upstream 441515 24199536 ~ 24210205 (-)
AMCG00021668 NA other upstream 584879 24342900 ~ 24363459 (-)
G87674 NA other upstream 1645629 25403650 ~ 25406538 (-)
G87806 NA other upstream 2147423 25905444 ~ 25908005 (-)
AMCG00021700 NA other upstream 2333206 26091227 ~ 26105391 (-)

Expression


Co-expression Network