AMCG00021649 (jazf1,LOC108242006,LOC108441515,LOC107550831,LOC572950)


Basic Information

Item Value
gene id AMCG00021649
gene name jazf1,LOC108242006,LOC108441515,LOC107550831,LOC572950
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 23885292 ~ 23892646 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021649
ATGACTGATGCAGCCCGTCGGGAGCAGGAATCCCTGAAAAAGAAGATCCAGCCCAAGCTGTCCCTGACCCTGTCCAGTGGAGTGTCCCGCGGGAATGTGTCCACGCCCCCCCGCCACAGCAGCGGCAGCCTGACGCCTCCTGTCACCCCCCCAATCACCCCGTCCTCGTCGTTCCGTAGCAGTACCCCCACAGGCAGCGAATACGACGAGGAAGAGGTGGACTATGAAGAATCGGACAGCGATGAGTCCTGGACCACGGAAAGTGCAATTAGCTCTGAGTCGATCCTCAGCTCCATGTGCATGAACGGCGGAGACGAGAAGCCGTTTGCCTGCCCTGTCCCTGGATGTAAGAAGAGATACAAGAATGTGAATGGTATCAAATACCATGCCAAGAATGGTCACAGAACACAGATCCGTGTGCGCAAACCGTTTAAGTGCCGTTGTGGGAAGAGTTACAAGGCTGCTCAGGGTCTCCGACACCACACCATCAATTTCCATCCTCCGGTGTCCGCCGAGATTATCCGGAAGATGCAGCAGTAA

Function

symbol description
jazf1 Enables transcription corepressor activity. Acts upstream of or within negative regulation of transcription by RNA polymerase II. Located in cytosol; fibrillar center; and nucleoplasm. Part of transcription repressor complex.

NR:

description
PREDICTED: juxtaposed with another zinc finger protein 1 isoform X2

GO: NA

KEGG:

id description
K19495 JAZF1; juxtaposed with another zinc finger protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021649 True 540 mRNA 0.56 3 23885292 23892646

Neighbor

gene id symbol gene type direction distance location
AMCG00021646 hibadh,LOC101062690,LOC106570522,LOC108441516 coding downstream 36801 23844671 ~ 23848491 (-)
AMCG00021647 hibadh,LOC107744697,LOC107596727,LOC107550829,LOC107685537,LOC107743154 coding downstream 60516 23813972 ~ 23824776 (-)
AMCG00021644 hoxa13b,LOC105018810 coding downstream 127271 23756876 ~ 23758021 (-)
AMCG00021643 NA coding downstream 142738 23732442 ~ 23742554 (-)
AMCG00021642 NA coding downstream 158148 23724461 ~ 23727144 (-)
AMCG00021650 NA coding upstream 41838 23934484 ~ 23942615 (-)
AMCG00021653 NA coding upstream 159944 24052590 ~ 24054872 (-)
AMCG00021652 LOC107743225,LOC107550833,LOC107743199 coding upstream 164157 24056803 ~ 24073972 (-)
AMCG00021660 fkbp14,LOC106943903 coding upstream 323222 24215868 ~ 24220678 (-)
AMCG00021661 NA coding upstream 344629 24237275 ~ 24256623 (-)
G87287 cbx3,LOC108425284,LOC105023664 non-coding downstream 397080 23482972 ~ 23488212 (-)
G87282 NA non-coding downstream 403392 23433216 ~ 23481900 (-)
G87269 NA non-coding downstream 513100 23371190 ~ 23372192 (-)
G87234 NA non-coding downstream 687449 23197581 ~ 23197843 (-)
G87218 NA non-coding downstream 779104 23093588 ~ 23106188 (-)
G87427 NA non-coding upstream 184253 24076899 ~ 24077107 (-)
G87428 LOC103376870 non-coding upstream 188090 24080736 ~ 24133311 (-)
G87495 NA non-coding upstream 385991 24278637 ~ 24279387 (-)
G87573 NA non-coding upstream 653436 24546082 ~ 24548123 (-)
G87627 NA non-coding upstream 1094796 24987442 ~ 24989739 (-)
AMCG00021634 NA other downstream 386531 23495025 ~ 23498761 (-)
G87263 NA other downstream 546808 23338251 ~ 23338484 (-)
AMCG00021630 NA other downstream 552324 23329325 ~ 23332968 (-)
AMCG00021619 NA other downstream 724301 23155187 ~ 23160991 (-)
AMCG00021569 NA other downstream 2213977 21666402 ~ 21671315 (-)
AMCG00021662 NA other upstream 306890 24199536 ~ 24210205 (-)
AMCG00021668 NA other upstream 450254 24342900 ~ 24363459 (-)
G87674 NA other upstream 1511004 25403650 ~ 25406538 (-)
G87806 NA other upstream 2012798 25905444 ~ 25908005 (-)
AMCG00021700 NA other upstream 2198581 26091227 ~ 26105391 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009849 jazf1b coding NC_007127.7 CM002900.2 20738740 ~ 20800498 (+)
grasscarp (Ctenopharyngodon idella) CI01000016_08217170_08228700 JAZF1 coding CI01000016 null 8217084 ~ 8228778 (+)