AMCG00021797 (LOC106570559,LOC105012503,LOC102295214)


Basic Information

Item Value
gene id AMCG00021797
gene name LOC106570559,LOC105012503,LOC102295214
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 30284672 ~ 30285136 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021797
ATGGCCAAAGGTGCTGACACAGCCTCAAACAGCTCTGTGCGGCTGAAGAAGGAGATCTCCTTGCTGCATGGGGTCTGTCTGATCGTGGGGAACATGATCGGATCTGGGATCTTCGTCTCGCCCAAGGGTGTCCTGCTGTACAGCGGCTCATATGGGCTCTCGCTGCTGGTATGGGTGATTGGAGGCATCTTTTCTGTGTTTGGAGCGCTTTGCTACGCAGAGCTTGGAACCACCATCAGGAAATCTGGAGCCAGCTATGCCTACATCCTGGAGTCTTTCGGGGGCTTTTTGGCCTTCATCAGGCTATGGACCTCCCTAATGATTGTGGAGCCAGCGTGCCAGGCGGTTATTGCACTTACCTTCTCCAACTACCTTGTGCAGCCCTTCTACCCCACCTGTCATCCCCCCTATGATGCCGTGCGACTCATAGCCGCTGCGATCATAGGTGAGAGGAACTCTTTTTAG

Function

NR:

description
PREDICTED: Y+L amino acid transporter 2-like

GO:

id name namespace
GO:0003333 amino acid transmembrane transport biological_process
GO:0016021 integral component of membrane cellular_component
GO:0015171 amino acid transmembrane transporter activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021797 True 465 mRNA 0.54 1 30284672 30285136

Neighbor

gene id symbol gene type direction distance location
AMCG00021796 LOC105009370,LOC106588819,LOC100696657,LOC107596629,LOC102210154,LOC107685565 coding downstream 19218 30256031 ~ 30265454 (-)
AMCG00021793 NA coding downstream 125965 30142222 ~ 30158707 (-)
AMCG00021788 NA coding downstream 235801 30047330 ~ 30048871 (-)
AMCG00021789 LOC105890378 coding downstream 239570 30042879 ~ 30045102 (-)
AMCG00021786 LOC106597666 coding downstream 298479 29974986 ~ 29986193 (-)
AMCG00021801 LOC107743838 coding upstream 96824 30381960 ~ 30386817 (-)
AMCG00021805 acot13,LOC102778390 coding upstream 109243 30394379 ~ 30395918 (-)
AMCG00021808 NA coding upstream 140980 30426116 ~ 30428501 (-)
AMCG00021807 NA coding upstream 148791 30433927 ~ 30444924 (-)
AMCG00021806 NA coding upstream 176875 30462011 ~ 30469642 (-)
G88435 NA non-coding downstream 337132 29888445 ~ 29947540 (-)
G88434 NA non-coding downstream 443133 29838518 ~ 29841539 (-)
G88347 NA non-coding downstream 1003799 29279361 ~ 29280873 (-)
G88245 NA non-coding downstream 1453448 28830158 ~ 28831224 (-)
G88244 NA non-coding downstream 1472707 28811763 ~ 28811965 (-)
G88545 NA non-coding upstream 140168 30425304 ~ 30425552 (-)
G88562 NA non-coding upstream 240610 30525746 ~ 30562800 (-)
G88643 NA non-coding upstream 676567 30961703 ~ 30962096 (-)
G88736 NA non-coding upstream 1513616 31798752 ~ 31836239 (-)
G88742 NA non-coding upstream 1574273 31859409 ~ 31859833 (-)
G88405 dtbp1,dtnbp1,LOC106596829,LOC106606149,LOC106596393 other downstream 541864 29730077 ~ 29742808 (-)
G88288 ctdp1,LOC107745039,LOC107698650,LOC107748359,LOC107672848 other downstream 1212912 29069201 ~ 29071760 (-)
G88242 LOC106595015,LOC106598893,LOC106597821 other downstream 1501391 28781802 ~ 28783281 (-)
AMCG00021723 hsf1 other downstream 3364828 26899963 ~ 26919844 (-)
AMCG00021719 ndrg1a other downstream 3566164 26674078 ~ 26718508 (-)
G88527 NA other upstream 52447 30337583 ~ 30424612 (-)
AMCG00021820 NA other upstream 592712 30877848 ~ 30888588 (-)
AMCG00021830 eny2,LOC100694417,LOC103393926 other upstream 844447 31129583 ~ 31132185 (-)
AMCG00021849 NA other upstream 1778249 32063385 ~ 32069464 (-)
AMCG00021867 LOC107596751,LOC107685553,LOC107743232 other upstream 3974868 34260004 ~ 34356907 (-)

Expression


Co-expression Network