AMCG00021837 (samd12,LOC107592942)


Basic Information

Item Value
gene id AMCG00021837
gene name samd12,LOC107592942
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 31755353 ~ 31763003 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021837
CCTGGGAATGTGAAGTTGACAAAACCAGTTGCTCTGTGGACCCAACAGGATGTCTGTAAGTGGCTAAAGAAACATTGTCCAAACCAGTATCAGATCTACAGCGATTCCTTCAAACAGCATGATATAACAGGCCGAGCGCTGATGAGACTGACAGATAAGAAGTTGGAGAGGATGGGCATTGCTCAGGAGAGCCAGAGGCAGTATATTCTGCAACAGGTGCTGCAGCTGAGAGTGCGAGAAGAGGTCCGGAACCTGCAGCTCTTAACACAA

Function

symbol description
samd12 Human ortholog(s) of this gene implicated in familial adult myoclonic epilepsy 1. Orthologous to human SAMD12 (sterile alpha motif domain containing 12).

NR:

description
PREDICTED: sterile alpha motif domain-containing protein 12 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021837 True 270 mRNA 0.49 2 31755353 31763003

Neighbor

gene id symbol gene type direction distance location
AMCG00021834 NA coding upstream 44276 31704641 ~ 31711077 (+)
AMCG00021838 angpt1,LOC106588502 coding upstream 78953 31673034 ~ 31676400 (+)
AMCG00021836 NA coding upstream 102354 31635170 ~ 31652999 (+)
AMCG00021839 NA coding upstream 171096 31583041 ~ 31584257 (+)
AMCG00021835 rspo2,LOC107679648,LOC107600624,LOC107755916,LOC107705839 coding upstream 309698 31419506 ~ 31445655 (+)
AMCG00021841 LOC101464589,LOC102196503,LOC102793765,LOC106588504 coding downstream 107069 31870072 ~ 31871025 (+)
AMCG00021840 LOC108430552,LOC106928852,LOC106964918 coding downstream 191584 31954587 ~ 31981028 (+)
AMCG00021842 NA coding downstream 296113 32059116 ~ 32065047 (+)
AMCG00021843 rad21,LOC108243945 coding downstream 319131 32082134 ~ 32092685 (+)
AMCG00021850 NA coding downstream 375569 32138572 ~ 32146026 (+)
G88677 LOC101154678 non-coding upstream 540684 31214309 ~ 31214669 (+)
G88666 NA non-coding upstream 623118 31130347 ~ 31132235 (+)
G88655 NA non-coding upstream 706824 31047803 ~ 31048529 (+)
G88609 NA non-coding upstream 1024485 30727284 ~ 30730868 (+)
G88485 NA non-coding upstream 1497156 30256024 ~ 30258197 (+)
G88741 NA non-coding downstream 95832 31858835 ~ 31859037 (+)
G88743 NA non-coding downstream 96918 31859921 ~ 31860135 (+)
G88746 NA non-coding downstream 131464 31894467 ~ 31986530 (+)
G88761 NA non-coding downstream 225781 31988784 ~ 31989051 (+)
G88771 NA non-coding downstream 265955 32028958 ~ 32029166 (+)
AMCG00021802 kdm1b other upstream 1286433 30449957 ~ 30468920 (+)
AMCG00021803 clg22h6orf62,clg10h6orf62,c24h6orf62,LOC106515831,LOC101464686,LOC108240366,LOC104924567,LOC102228185,LOC103135136 other upstream 1347581 30267402 ~ 30407772 (+)
AMCG00021779 LOC108438266,LOC105891906 other upstream 2370028 29378575 ~ 29385325 (+)
AMCG00021772 NA other upstream 2480006 29264827 ~ 29275347 (+)
G88276 NA other upstream 2690014 29060887 ~ 29065339 (+)
AMCG00021881 LOC107748698,LOC102792383,LOC101481807,LOC108256925,LOC106919167,LOC108434168 other downstream 3163550 34926553 ~ 35077090 (+)
G89142 NA other downstream 3448130 35211133 ~ 35263537 (+)
G89299 NA other downstream 4201568 35964571 ~ 35967384 (+)
AMCG00021900 NA other downstream 4887229 36650232 ~ 36659244 (+)
G89578 NA other downstream 6358254 38121257 ~ 38151049 (+)

Expression


Co-expression Network