AMCG00021907 (galr1,LOC107373077,LOC102797365)


Basic Information

Item Value
gene id AMCG00021907
gene name galr1,LOC107373077,LOC102797365
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 37957755 ~ 37958533 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021907
ATGGTGATAACAGTGCTGGCCCGAAGCAAGCCGGGCAAACCTCGGAGCACCTCCAATATCTTCATCCTAAACCTCAGCATAGCCGACCTCTCTTACCTGCTGTTCTGCATCCCTTTCCAATCCACCGTCTACATGCTGCCAACATGGGTCCTGGGAGCTTTCATCTGCAAGTTCATACACTACTTTTTTACAGTGTCAATGCTGGTCAGTATTTTCACGCTTTCTGCCATGTCCGTGGACCGCTATATTGCCATCGTCCACTCCAGAAAGTCATCTTCGATTCGAGTAGCGCGGCACGCACTGATGGGAGTCATAGCTATATGGATGCTCTCACTAGCCATGGCTGCACCGGTTGCCTACCACCAGAACATTGTCGAAAGGAAAGGAAACGTCATGGCCAAGTAG

Function

symbol description
galr1 Enables galanin receptor activity and peptide hormone binding activity. Involved in positive regulation of cortisol secretion and positive regulation of transcription by RNA polymerase II. Located in nucleoplasm and plasma membrane.

NR:

description
PREDICTED: galanin receptor type 1-like

GO:

id name namespace
GO:0007194 negative regulation of adenylate cyclase activity biological_process
GO:0007204 positive regulation of cytosolic calcium ion concentration biological_process
GO:0007218 neuropeptide signaling pathway biological_process
GO:0007268 chemical synaptic transmission biological_process
GO:0016021 integral component of membrane cellular_component
GO:0004966 galanin receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021907 True 405 mRNA 0.51 2 37957755 37958533

Neighbor

gene id symbol gene type direction distance location
AMCG00021906 sall3,LOC103388658,LOC102796582,LOC103369140 coding downstream 722914 37212616 ~ 37234841 (-)
AMCG00021905 NA coding downstream 786376 37091198 ~ 37171379 (-)
AMCG00021904 NA coding downstream 958115 36992851 ~ 36999640 (-)
AMCG00021903 atp9b coding downstream 982639 36944033 ~ 36975116 (-)
AMCG00021901 NA coding downstream 1083545 36867843 ~ 36874210 (-)
AMCG00021909 NA coding upstream 221547 38180080 ~ 38224604 (-)
AMCG00021908 NA coding upstream 279605 38238138 ~ 38245037 (-)
AMCG00021913 tshz1,LOC107592027,LOC107748691,LOC107696938,LOC107593600 coding upstream 860878 38819411 ~ 38826295 (-)
AMCG00021921 NA coding upstream 980074 38938607 ~ 38945501 (-)
AMCG00021920 znf407,LOC106583495,LOC106605077 coding upstream 1086252 39044785 ~ 39052673 (-)
G89567 NA non-coding downstream 15075 37942347 ~ 37942680 (-)
G89566 NA non-coding downstream 64743 37892794 ~ 37893012 (-)
G89565 NA non-coding downstream 138986 37818562 ~ 37818769 (-)
G89562 NA non-coding downstream 196734 37760817 ~ 37761021 (-)
G89559 NA non-coding downstream 343159 37614397 ~ 37614596 (-)
G89570 NA non-coding upstream 21556 37980089 ~ 37980414 (-)
G89584 NA non-coding upstream 176727 38135260 ~ 38151050 (-)
G89587 NA non-coding upstream 194695 38153228 ~ 38153513 (-)
G89588 NA non-coding upstream 196227 38154760 ~ 38155121 (-)
G89609 NA non-coding upstream 390690 38349223 ~ 38349555 (-)
AMCG00021897 smim13,si:dkey-206d17.5,LOC107559689,LOC107551766 other downstream 1270113 36677106 ~ 36687642 (-)
AMCG00021896 tmem170b,LOC107734028,LOC107669975 other downstream 1420037 36524509 ~ 36537718 (-)
AMCG00021895 LOC102226217,LOC106946249,LOC103472391,LOC107092461,LOC103135126,LOC106918615,LOC105905342,LOC104924555,LOC108426791,LOC100705487 other downstream 1519405 36414879 ~ 36438350 (-)
G89368 NA other downstream 2010771 35943752 ~ 35946984 (-)
G89217 kif13a,LOC101479097,LOC102301062,LOC102786386 other downstream 2561984 35375016 ~ 35395771 (-)
G89598 NA other upstream 302854 38261387 ~ 38283855 (-)
G89611 NA other upstream 437038 38395571 ~ 38397755 (-)
AMCG00021918 cndp2,LOC103371436,LOC104951856,LOC105892098,LOC106958632,LOC106588296,LOC102776275 other upstream 1297346 39255879 ~ 39276056 (-)
G89765 NA other upstream 1527300 39485833 ~ 39486288 (-)
AMCG00021924 eppk1,LOC106938278,LOC107592034 other upstream 1528364 39486897 ~ 39548802 (-)

Expression


Co-expression Network