G83342 (zc3h12b)



Basic Information


Item Value
gene id G83342
gene name zc3h12b
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 2079669 ~ 2080014 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU103996
CACACACTATAGCCAAGATGAGAGCAATCTGAATCCGTAGAGCTGTACGTGTAATATCGATTAAGTTATTTTCCTCAAAGACCACATCGTCAGATTTGCACCCAAGTGCCTTACTTGTCATTGACGAACGAGTACATGAGCAGGCGCTCCTCGATGAACTTCTTCCACTCCGGCTTCTCGTTCTGCAGGTCCCGGTAGTTGTCGTTGGACACGATGATGCCGTCCGAGTCGTAGGCGAGCTTCACGATGAAGCGGTCGTCGTAGCAGACCACCCTCCGGCCCTGGACTCGCCGGGAGGGAGTGAAGACAAGGATCTTCTCTTTCTCGAGCTTCCGCAGGATCTCCT

Function


symbol description
zc3h12b Predicted to enable endoribonuclease activity and mRNA binding activity. Predicted to be involved in RNA phosphodiester bond hydrolysis, endonucleolytic. Predicted to be active in cytoplasmic ribonucleoprotein granule and nucleus. Is expressed in optic vesicle; presumptive neural retina; and retina. Orthologous to human ZC3H12B (zinc finger CCCH-type containing 12B).

NR:

description
PREDICTED: probable ribonuclease ZC3H12B

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU103996 True 346 lncRNA 0.53 1 2079669 2080014

Neighbor


gene id symbol gene type direction distance location
AMCG00021072 zc4h2,LOC107557113,LOC107597258,LOC107663226,LOC107672730 coding downstream 22284 2049196 ~ 2057385 (-)
AMCG00021068 NA coding downstream 105561 1973785 ~ 1974108 (-)
AMCG00021069 NA coding downstream 106132 1969250 ~ 1973537 (-)
AMCG00021065 LOC106603315 coding downstream 126793 1931558 ~ 1952876 (-)
AMCG00021067 NA coding downstream 151811 1926713 ~ 1927858 (-)
AMCG00021075 NA coding upstream 6612 2086626 ~ 2106886 (-)
AMCG00021078 NA coding upstream 77635 2157649 ~ 2176534 (-)
AMCG00021077 NA coding upstream 150494 2230508 ~ 2245691 (-)
AMCG00021082 NA coding upstream 322160 2402174 ~ 2412334 (-)
AMCG00021085 NA coding upstream 442846 2522860 ~ 2576954 (-)
G83294 NA non-coding downstream 214442 1854882 ~ 1865227 (-)
G83205 NA non-coding downstream 1153105 922859 ~ 926564 (-)
G83091 NA non-coding downstream 1994542 84874 ~ 85127 (-)
G83081 NA non-coding downstream 2042778 36247 ~ 36891 (-)
G83343 NA non-coding upstream 3163 2083177 ~ 2086079 (-)
G83346 NA non-coding upstream 25050 2105064 ~ 2106398 (-)
G83352 msn,LOC106567791,LOC102776036 non-coding upstream 60276 2140290 ~ 2141743 (-)
G83355 NA non-coding upstream 64390 2144404 ~ 2147117 (-)
G83371 NA non-coding upstream 110612 2190626 ~ 2190909 (-)
G83313 NA other downstream 101701 1973160 ~ 1977968 (-)
G83428 NA other upstream 376987 2457001 ~ 2459379 (-)
AMCG00021090 NA other upstream 597571 2677585 ~ 2718919 (-)
G83761 NA other upstream 2623241 4703255 ~ 4751235 (-)
G83864 NA other upstream 4464478 6544492 ~ 6546577 (-)
AMCG00021153 NA other upstream 5035406 7115420 ~ 7122491 (-)

Expression



Co-expression Network