G84307



Basic Information


Item Value
gene id G84307
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 8701579 ~ 8701918 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU105173
acgtgagcatcagaactggaccacagagcaatggaagaaggtggcctggtctgatgaatcacgagttcaaggtgttgacttggcctccaaattccccagctctcaatccaatcgagcatctgtgggatgtgctggacaaacaagtccgatccatggaggccccacctcgcaacttacaggacttaaaggatctgctgctaacgtcttggtgccagataccacagcacaccttcagaggtctagtggagtccatgccttgacgggtcaaggctgttttggcggcaaaagggggacctacacaatattaggcaggtggtcataatgttatggctgatcggtg

Function


GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA


RNA id representative length rna type GC content exon number start site end site
TU105173 True 340 lncRNA 0.52 1 8701579 8701918

Neighbor


gene id symbol gene type direction distance location
AMCG00021202 NA coding downstream 64688 8631672 ~ 8636891 (-)
AMCG00021208 NA coding downstream 97903 8591024 ~ 8603676 (-)
AMCG00021209 mtm1,LOC106577925 coding downstream 121564 8558232 ~ 8580015 (-)
AMCG00021191 NA coding downstream 152961 8541641 ~ 8548618 (-)
AMCG00021193 NA coding downstream 185657 8379989 ~ 8515922 (-)
AMCG00021201 NA coding upstream 59785 8761703 ~ 8763622 (-)
AMCG00021204 tmem185a,t185l,LOC106563673,LOC108429425 coding upstream 67415 8769333 ~ 8774394 (-)
AMCG00021203 NA coding upstream 100344 8802262 ~ 8818843 (-)
AMCG00021205 NA coding upstream 280578 8982496 ~ 8999604 (-)
AMCG00021206 dach2,LOC107581921 coding upstream 366100 9068018 ~ 9074386 (-)
G84305 NA non-coding downstream 111091 8589220 ~ 8590488 (-)
G84304 NA non-coding downstream 112526 8587569 ~ 8589053 (-)
G84203 NA non-coding downstream 494029 8201759 ~ 8207550 (-)
G84184 NA non-coding downstream 584752 8064531 ~ 8116827 (-)
G84188 NA non-coding downstream 626881 8072093 ~ 8074698 (-)
G84311 NA non-coding upstream 39243 8741161 ~ 8741413 (-)
G84332 hmgb3a,LOC106563671,LOC107750581,LOC107678073,LOC107561946 non-coding upstream 134357 8836275 ~ 8840659 (-)
G84514 NA non-coding upstream 1385786 10087704 ~ 10090475 (-)
G84603 NA non-coding upstream 1711257 10413175 ~ 10414481 (-)
G84614 NA non-coding upstream 1772499 10474417 ~ 10477459 (-)
AMCG00021153 NA other downstream 1579088 7115420 ~ 7122491 (-)
G83864 NA other downstream 2155002 6544492 ~ 6546577 (-)
G83761 NA other downstream 3950344 4703255 ~ 4751235 (-)
AMCG00021090 NA other downstream 5982660 2677585 ~ 2718919 (-)
G83428 NA other downstream 6242200 2457001 ~ 2459379 (-)
AMCG00021249 NA other upstream 3391559 12093477 ~ 12100854 (-)
G84814 NA other upstream 3825175 12527093 ~ 12527694 (-)
AMCG00021259 diaph2 other upstream 4017946 12719864 ~ 12801586 (-)
G84952 NA other upstream 4925417 13627335 ~ 13627747 (-)
G85037 LOC100846954 other upstream 5168021 13869939 ~ 13917868 (-)

Expression



Co-expression Network