G84936 (nox1,LOC106611713)


Basic Information

Item Value
gene id G84936
gene name nox1,LOC106611713
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 13600205 ~ 13601928 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU105969
CGTTGAAAGGCGTGGTTTGCATGTGCATTTAAAGTTAGGTACGTGCCAACAGGTGTCTTATATTGTACAGAAACAGCACCTGGCAAGACTCGGCCTACCAGAATGGGCAACTGGATTGTAAACCATGGCTTATCGGCTCTTATACTGGTTGTGTGGATGGCAATTAATATATTCCTGTTTTTATACTTCTACTTTTTGTACGACTTGGGAGATGAGTATATCTACACCCGCCATCTTATTGGGTCTGCCTTGTCATGGGCACGCGCACCTGCTGCTGTCCTCAACTTTAACTGCCTGCTGATCCTGCTCCCAGTGTGCAGGAACTTGCTGTCTCTAGTCCGAGGATCCTTCATG

Function

symbol description
nox1 Predicted to enable superoxide-generating NAD(P)H oxidase activity. Predicted to be involved in defense response and superoxide anion generation. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of NADPH oxidase complex. Predicted to be active in plasma membrane. Is expressed in nervous system. Orthologous to human NOX1 (NADPH oxidase 1).

NR:

description
PREDICTED: NADPH oxidase 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU105969 True 354 lncRNA 0.47 3 13600205 13601928

Neighbor

gene id symbol gene type direction distance location
AMCG00021277 NA coding upstream 1190 13586894 ~ 13599015 (+)
AMCG00021266 LOC107740154 coding upstream 145353 13448596 ~ 13454852 (+)
AMCG00021263 taf7l,taf7 coding upstream 152687 13442785 ~ 13447518 (+)
AMCG00021265 NA coding upstream 166676 13419812 ~ 13433529 (+)
AMCG00021264 NA coding upstream 193198 13402634 ~ 13407007 (+)
AMCG00021276 NA coding downstream 20921 13622849 ~ 13630470 (+)
AMCG00021275 NA coding downstream 48335 13650263 ~ 13662469 (+)
AMCG00021279 NA coding downstream 91440 13693368 ~ 13704090 (+)
AMCG00021280 zdhhc9,LOC105893011 coding downstream 129768 13731696 ~ 13752149 (+)
AMCG00021281 NA coding downstream 246304 13848232 ~ 13850457 (+)
G84923 NA non-coding upstream 27758 13571771 ~ 13572447 (+)
G84837 NA non-coding upstream 538442 13056182 ~ 13061763 (+)
G84825 LOC107690093,LOC107593228,LOC107740173,LOC107680956,LOC107554828 non-coding upstream 760996 12800829 ~ 12839209 (+)
G84803 NA non-coding upstream 1261998 12337997 ~ 12338207 (+)
G84801 NA non-coding upstream 1263066 12336802 ~ 12337139 (+)
G84938 NA non-coding downstream 1930 13603858 ~ 13604159 (+)
G84962 NA non-coding downstream 79009 13680937 ~ 13685245 (+)
G85006 NA non-coding downstream 259742 13861670 ~ 13862498 (+)
G85013 LOC100846954 non-coding downstream 267634 13869562 ~ 13917871 (+)
G85019 NA non-coding downstream 294991 13896919 ~ 13899981 (+)
AMCG00021267 timm8a,LOC107593201 other upstream 162797 13435307 ~ 13437408 (+)
G84749 NA other upstream 1499498 12075345 ~ 12100707 (+)
G84657 slitrk2,LOC106611993,LOC106604961,LOC107688026,LOC107588360 other upstream 2613031 10963148 ~ 10987174 (+)
AMCG00021240 LOC107742636 other upstream 2880878 10470063 ~ 10719327 (+)
G84425 NA other upstream 4176786 9416267 ~ 9423419 (+)
AMCG00021296 NA other downstream 414205 14016133 ~ 14033557 (+)
AMCG00021292 NA other downstream 467402 14069330 ~ 14073125 (+)
AMCG00021349 mmgt1,tmm32,LOC107658091,LOC107560676,LOC102787804 other downstream 1826549 15428477 ~ 15432364 (+)
AMCG00021373 ubl3b,LOC107658069,LOC107707244,LOC108432919,LOC101472018,LOC107092570,LOC105029324,LOC100692344,LOC103390851 other downstream 2461571 16063499 ~ 16073621 (+)
G85764 LOC103366846,LOC106930986 other downstream 2988253 16590181 ~ 16592973 (+)

Expression


Co-expression Network