G86905


Basic Information

Item Value
gene id G86905
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 21638276 ~ 21638516 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU108467
gaggtcaaggactctgctgttttgacttcggtgggcaggtcgttccaccatttaggggccagggatgagaaggagcggctctggaggaaggagagtggagaggaggcagagttagccttctggcactggaggagcgcagtggtctggaggggatgtatggagagacgagtgactgaaggtagcttggtgcagtgtggtcaagacagcggtaggtgagggtcaatgtcttgaactgaatgcg

Function

GO:

id name namespace
GO:0045936 negative regulation of phosphate metabolic process biological_process
GO:0042326 negative regulation of phosphorylation biological_process
GO:0010563 negative regulation of phosphorus metabolic process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU108467 True 241 lncRNA 0.56 1 21638276 21638516

Neighbor

gene id symbol gene type direction distance location
AMCG00021566 phf14,LOC107722156,LOC107698992 coding upstream 33213 21574050 ~ 21605063 (+)
AMCG00021565 LOC108410782,LOC107670023,LOC107698976,LOC107722163,LOC107555956 coding upstream 276674 21360168 ~ 21361602 (+)
AMCG00021563 NA coding upstream 347184 21269203 ~ 21291092 (+)
AMCG00021556 NA coding upstream 443674 21192962 ~ 21194602 (+)
AMCG00021555 NA coding upstream 445519 21180802 ~ 21192757 (+)
AMCG00021567 NA coding downstream 19026 21657542 ~ 21659873 (+)
AMCG00021570 tmem106b,LOC107584266,LOC107724356,LOC107709260,LOC107696205,LOC107702131,LOC108425340,LOC103043314 coding downstream 176454 21814970 ~ 21828220 (+)
AMCG00021571 NA coding downstream 194307 21832823 ~ 21834923 (+)
AMCG00021573 NA coding downstream 232137 21870653 ~ 21872068 (+)
AMCG00021574 NA coding downstream 239640 21878156 ~ 21897029 (+)
G86892 NA non-coding upstream 122033 21516033 ~ 21516243 (+)
G86884 NA non-coding upstream 340496 21295531 ~ 21297780 (+)
G86859 NA non-coding upstream 400113 21237101 ~ 21238163 (+)
G86833 LOC107754811,LOC107672863,LOC107731557 non-coding upstream 462617 21172090 ~ 21175659 (+)
G86800 NA non-coding upstream 599851 21035102 ~ 21038425 (+)
G87030 agr2 non-coding downstream 665050 22303566 ~ 22306888 (+)
G87086 twist1 non-coding downstream 948698 22587214 ~ 22588925 (+)
G87091 NA non-coding downstream 990104 22628620 ~ 22628886 (+)
G87168 NA non-coding downstream 1368878 23007394 ~ 23014831 (+)
G87215 NA non-coding downstream 1506488 23145004 ~ 23191753 (+)
AMCG00021560 NA other upstream 381087 21241666 ~ 21257189 (+)
G86861 mios,LOC106605261,LOC106582151 other upstream 402196 21235070 ~ 21236080 (+)
AMCG00021561 LOC106582151,LOC105891776,LOC106605261 other upstream 405423 21229852 ~ 21232853 (+)
AMCG00021551 NA other upstream 472776 21158624 ~ 21165500 (+)
AMCG00021550 NA other upstream 528908 21098419 ~ 21109368 (+)
AMCG00021591 NA other downstream 632355 22270871 ~ 22291141 (+)
AMCG00021602 NA other downstream 1058648 22697164 ~ 22711144 (+)
AMCG00021656 NA other downstream 2535887 24174403 ~ 24178092 (+)
AMCG00021657 NA other downstream 2544692 24183208 ~ 24198827 (+)
AMCG00021676 kcnh8,LOC106570508,LOC106941718 other downstream 3271368 24909884 ~ 24949100 (+)

Expression


Co-expression Network