G88288 (ctdp1,LOC107745039,LOC107698650,LOC107748359,LOC107672848)


Basic Information

Item Value
gene id G88288
gene name ctdp1,LOC107745039,LOC107698650,LOC107748359,LOC107672848
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 29069201 ~ 29071760 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU110186
AGCAAGCAGAGCAGCTGGGAAGGGAAGACCAACACAGACTGCACCGGAATAGGAAGCTTGTGTTGATGGTGGACTTGGACCAGACGCTCATCCACACTACTGAGCAGAACTGCCAGCGCATGTCCAATAAGGGAATTTTCCACTTTCAGCTGGGCCGAGGGGAACCCATGTTGCACACGCGGCTCCGCCCACACTGCAAAGACTTCCTGGAGAAGATAGCCAAGCTGTACGAGCTGCACGTGTTTACCTTCGGAAGCCGGCTGTACGCACACACCATAGCAGGTATGCAAAATCGCCTCGGAAAAGTGTGCAGGGTTAGACATTCACCTTAAGTGGCTTTCAGGTCCCTTCATTCCTCACCGTGGTGGCTGA

Function

symbol description
ctdp1 Predicted to enable RNA polymerase II CTD heptapeptide repeat phosphatase activity. Predicted to be involved in dephosphorylation of RNA polymerase II C-terminal domain. Predicted to be located in nucleus. Orthologous to human CTDP1 (CTD phosphatase subunit 1).

NR:

description
PREDICTED: RNA polymerase II subunit A C-terminal domain phosphatase-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU110186 True 372 TUCP 0.54 2 29069201 29071760

Neighbor

gene id symbol gene type direction distance location
AMCG00021767 NA coding downstream 21729 29043498 ~ 29047472 (-)
AMCG00021757 khdrbs3,LOC106521499,LOC106531515 coding downstream 477399 28586176 ~ 28591802 (-)
AMCG00021756 NA coding downstream 830061 28234640 ~ 28239140 (-)
AMCG00021755 NA coding downstream 850486 28215822 ~ 28218715 (-)
AMCG00021747 NA coding downstream 1428292 27638582 ~ 27640909 (-)
AMCG00021771 pqlc1 coding upstream 190692 29262452 ~ 29264433 (-)
AMCG00021770 txnl4a,txnl4a.S,txn4a,LOC107593623,LOC106570226 coding upstream 196654 29268414 ~ 29271589 (-)
AMCG00021774 NA coding upstream 201332 29273092 ~ 29275349 (-)
AMCG00021773 NA coding upstream 209796 29281556 ~ 29285963 (-)
AMCG00021775 NA coding upstream 236127 29307887 ~ 29315441 (-)
G88245 NA non-coding downstream 237977 28830158 ~ 28831224 (-)
G88244 NA non-coding downstream 257236 28811763 ~ 28811965 (-)
G88243 zfat,LOC107723386 non-coding downstream 283540 28785166 ~ 28785661 (-)
G88241 NA non-coding downstream 289491 28779343 ~ 28779710 (-)
G88240 NA non-coding downstream 290516 28778293 ~ 28778685 (-)
G88347 NA non-coding upstream 207601 29279361 ~ 29280873 (-)
G88434 NA non-coding upstream 766758 29838518 ~ 29841539 (-)
G88435 NA non-coding upstream 816685 29888445 ~ 29947540 (-)
G88545 NA non-coding upstream 1353544 30425304 ~ 30425552 (-)
G88562 NA non-coding upstream 1453986 30525746 ~ 30562800 (-)
G88242 LOC106595015,LOC106598893,LOC106597821 other downstream 285920 28781802 ~ 28783281 (-)
AMCG00021723 hsf1 other downstream 2149357 26899963 ~ 26919844 (-)
AMCG00021719 ndrg1a other downstream 2350693 26674078 ~ 26718508 (-)
G87871 NA other downstream 2914826 26152105 ~ 26154375 (-)
AMCG00021700 NA other downstream 2963810 26091227 ~ 26105391 (-)
G88405 dtbp1,dtnbp1,LOC106596829,LOC106606149,LOC106596393 other upstream 658317 29730077 ~ 29742808 (-)
G88527 NA other upstream 1265823 30337583 ~ 30424612 (-)
AMCG00021820 NA other upstream 1806088 30877848 ~ 30888588 (-)
AMCG00021830 eny2,LOC100694417,LOC103393926 other upstream 2057823 31129583 ~ 31132185 (-)
AMCG00021849 NA other upstream 2991625 32063385 ~ 32069464 (-)

Expression


Co-expression Network