G88762


Basic Information

Item Value
gene id G88762
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 31988774 ~ 31989050 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU110768
AAAGAAAGGCAGACTGCCCCGTGCAGCGCCGGACTCAGATGTGTGTGGACTCTCGGAGCTTGGCTCTCCTACAATTACGTCTGTTTGGAGATTCTTAGCAGGGGAGCAGCTACTCGTTCCCGGTGACCGGTCCTCTGCCACCGAGCGCGGGGCTTCGGGAGGGACGCCCATGGAGGATGAGGGAGGAAGGGGACACCCGCCTAGCCAGATCAGCCGAATCAACCTTAGCGATCAATGGGGAGTTACAGATGTCGCAGCCAGTTCGCCCTCACATCCA

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU110768 True 277 lncRNA 0.60 1 31988774 31989050

Neighbor

gene id symbol gene type direction distance location
AMCG00021828 LOC107600623,LOC107666844,LOC107551188,LOC105905365,LOC107705775 coding downstream 638406 31310586 ~ 31350368 (-)
AMCG00021826 NA coding downstream 763393 31221983 ~ 31225381 (-)
AMCG00021831 NA coding downstream 880128 31093408 ~ 31108646 (-)
AMCG00021829 NA coding downstream 895404 31058059 ~ 31093370 (-)
AMCG00021827 ebag9,LOC107666870,LOC107705161,LOC107600620 coding downstream 937590 31042531 ~ 31051184 (-)
AMCG00021848 med30,LOC107706236,LOC107754270 coding upstream 22392 32011442 ~ 32018134 (-)
AMCG00021847 NA coding upstream 42638 32031688 ~ 32037579 (-)
AMCG00021846 NA coding upstream 58060 32047110 ~ 32047584 (-)
AMCG00021845 NA coding upstream 106475 32095525 ~ 32097519 (-)
AMCG00021861 NA coding upstream 2017609 34006659 ~ 34014890 (-)
G88742 NA non-coding downstream 128941 31859409 ~ 31859833 (-)
G88736 NA non-coding downstream 152535 31798752 ~ 31836239 (-)
G88643 NA non-coding downstream 1026678 30961703 ~ 30962096 (-)
G88562 NA non-coding downstream 1425974 30525746 ~ 30562800 (-)
G88545 NA non-coding downstream 1563222 30425304 ~ 30425552 (-)
G88795 NA non-coding upstream 105652 32094702 ~ 32094939 (-)
G88831 NA non-coding upstream 703221 32692271 ~ 32692496 (-)
G88866 NA non-coding upstream 1681417 33670467 ~ 33670919 (-)
G88871 NA non-coding upstream 1771222 33760272 ~ 33760620 (-)
G88873 NA non-coding upstream 1772192 33761242 ~ 33761474 (-)
AMCG00021830 eny2,LOC100694417,LOC103393926 other downstream 856589 31129583 ~ 31132185 (-)
AMCG00021820 NA other downstream 1100186 30877848 ~ 30888588 (-)
G88527 NA other downstream 1564162 30337583 ~ 30424612 (-)
G88405 dtbp1,dtnbp1,LOC106596829,LOC106606149,LOC106596393 other downstream 2245966 29730077 ~ 29742808 (-)
G88288 ctdp1,LOC107745039,LOC107698650,LOC107748359,LOC107672848 other downstream 2917014 29069201 ~ 29071760 (-)
AMCG00021849 NA other upstream 74335 32063385 ~ 32069464 (-)
AMCG00021867 LOC107596751,LOC107685553,LOC107743232 other upstream 2270954 34260004 ~ 34356907 (-)
G89004 LOC107685553,LOC107596751,LOC107743232,LOC107662664,LOC108270036 other upstream 2357938 34346988 ~ 34380295 (-)
AMCG00021868 slc6a19b,LOC108270036,LOC107596751,LOC107685553,LOC107743232,LOC106606020 other upstream 2389651 34378701 ~ 34388010 (-)
G89217 kif13a,LOC101479097,LOC102301062,LOC102786386 other upstream 3385966 35375016 ~ 35395771 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_006338 rn7sk misc NC_007124.7 CM002897.2 825904 ~ 826225 (-)
rainbow trout (Oncorhynchus mykiss) G1687845 NA non-coding NC_048584.1 CM023238.2 34626718 ~ 34683245 (+)
eurasian perch (Perca fluviatilis) G195003 NA non-coding NC_053130.1 CM020927.1 19071050 ~ 19071340 (+)
striped catfish (Pangasianodon hypophthalmus) G53729 NA non-coding NC_047597.1 CM018543.1 27530576 ~ 27803450 (-)
bowfin (Amia calva) G50736 cdk2,LOC107683630,LOC107570445,LOC107737371,LOC107696023 non-coding CM030126.1 CM030126.1 8357450 ~ 8360962 (-)