G88937


Basic Information

Item Value
gene id G88937
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 34176389 ~ 34176706 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU110959
GTTTGCTACTTTTGCAAAGCCACTATATGAACTTTTGCGGAAAGAGGTGCCTGAAGATTTCTACAGTACTGAAACTTGGACAGAGAACCACACCAAAGCCGTTGAACAGTTAAAACAAGCATTGATGCAAGCTACTGTGCTGCTAACTCCAAACCCTACACTACCTTTTCACCTAGAGGTGGGCTCCTCCAAAGAAGCACTGACTGCTGTGCTTTGTCAAGAACGCCACGGTGTGCTGAAACCAGTAGCCTTCGCTTCACGGTGTCTTCAGGGTGTTGAGAGACAGTATGATACGTGCACTAGACACTTGTTAGCGAC

Function

GO: NA

KEGG:

id description
ko00260 Glycine, serine and threonine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU110959 True 318 lncRNA 0.47 1 34176389 34176706

Neighbor

gene id symbol gene type direction distance location
AMCG00021858 NA coding upstream 354303 33810474 ~ 33822086 (+)
AMCG00021855 csmd3,LOC106570400 coding upstream 589889 33548596 ~ 33586500 (+)
AMCG00021856 csmd3 coding upstream 638479 33475168 ~ 33537910 (+)
AMCG00021854 csmd3 coding upstream 722736 33435316 ~ 33453653 (+)
AMCG00021857 csmd3 coding upstream 781164 33382419 ~ 33395225 (+)
AMCG00021859 clptm1l coding downstream 97960 34274666 ~ 34286319 (+)
AMCG00021862 NA coding downstream 128243 34304949 ~ 34323922 (+)
AMCG00021869 NA coding downstream 230143 34406849 ~ 34413209 (+)
AMCG00021876 fhod3,LOC108413044,LOC102209662,LOC102799816 coding downstream 420210 34596916 ~ 34607621 (+)
AMCG00021873 fhod3 coding downstream 448342 34625048 ~ 34678756 (+)
G88927 NA non-coding upstream 20423 34155421 ~ 34155966 (+)
G88887 NA non-coding upstream 217209 33958595 ~ 33959180 (+)
G88884 NA non-coding upstream 264614 33911420 ~ 33911775 (+)
G88882 NA non-coding upstream 331049 33845096 ~ 33845340 (+)
G88872 NA non-coding upstream 414915 33761243 ~ 33761474 (+)
G88938 NA non-coding downstream 248 34176954 ~ 34177478 (+)
G88980 NA non-coding downstream 193264 34369970 ~ 34373665 (+)
G88981 slc6a19b,LOC106570715,LOC107596751,LOC107743232,LOC107685553,LOC107662664 non-coding downstream 207253 34383959 ~ 34386202 (+)
G89006 NA non-coding downstream 210548 34387254 ~ 34387672 (+)
G89010 NA non-coding downstream 243085 34419791 ~ 34420057 (+)
AMCG00021802 kdm1b other upstream 3707469 30449957 ~ 30468920 (+)
AMCG00021803 clg22h6orf62,clg10h6orf62,c24h6orf62,LOC106515831,LOC101464686,LOC108240366,LOC104924567,LOC102228185,LOC103135136 other upstream 3768617 30267402 ~ 30407772 (+)
AMCG00021779 LOC108438266,LOC105891906 other upstream 4791064 29378575 ~ 29385325 (+)
AMCG00021772 NA other upstream 4901042 29264827 ~ 29275347 (+)
G88276 NA other upstream 5111050 29060887 ~ 29065339 (+)
AMCG00021881 LOC107748698,LOC102792383,LOC101481807,LOC108256925,LOC106919167,LOC108434168 other downstream 749847 34926553 ~ 35077090 (+)
G89142 NA other downstream 1034427 35211133 ~ 35263537 (+)
G89299 NA other downstream 1787865 35964571 ~ 35967384 (+)
AMCG00021900 NA other downstream 2473526 36650232 ~ 36659244 (+)
G89578 NA other downstream 3944551 38121257 ~ 38151049 (+)

Expression


Co-expression Network