G89597 (znf236)


Basic Information

Item Value
gene id G89597
gene name znf236
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 38248914 ~ 38250240 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU111770
AGGCCTATCATTGGGAATTCAAGGAATTACAAGCGAAACATTGATAGGAGTGGGTTCACTAATAGGTGTCAACACTGCGGAAAGACATTCAAAAAGCCTAGCCAGCTGGTTCGTCATATTAGGATACATACAGGTGAACGACCCTATAAATGCACCCACTGTGGGAAGGCATTTAACCAGAAGGTGGTGCTGCAGACTCACATGGTGAGGCACACTGGAGAGAAGCCTCACTTCTGCATGCTGTGTCCAGCATCCTTCTCACAGAAGGGCAATCTGCATTCACACATACAAAGGGTCCATTCTGAGG

Function

symbol description
znf236 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. Orthologous to human ZNF236 (zinc finger protein 236).

NR:

description
PREDICTED: zinc finger protein 236

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU111770 True 307 lncRNA 0.47 2 38248914 38250240

Neighbor

gene id symbol gene type direction distance location
AMCG00021910 NA coding upstream 106755 38137122 ~ 38142159 (+)
AMCG00021911 NA coding upstream 127342 38120324 ~ 38121572 (+)
AMCG00021899 LOC108426911,LOC108257397,LOC107601986,LOC107707114,LOC107677659,LOC107591967 coding upstream 1747086 36465786 ~ 36501828 (+)
AMCG00021893 NA coding upstream 2235259 35984055 ~ 36013655 (+)
AMCG00021894 NA coding upstream 2361661 35864749 ~ 35887253 (+)
AMCG00021912 NA coding downstream 145566 38395806 ~ 38397674 (+)
AMCG00021914 NA coding downstream 605586 38855826 ~ 38865619 (+)
AMCG00021915 NA coding downstream 1108478 39358718 ~ 39369622 (+)
AMCG00021927 NA coding downstream 1210019 39460259 ~ 39461475 (+)
G89579 NA non-coding upstream 87280 38158553 ~ 38161634 (+)
G89583 NA non-coding upstream 93782 38154835 ~ 38155132 (+)
G89571 NA non-coding upstream 189380 38017304 ~ 38059534 (+)
G89554 NA non-coding upstream 646250 37602437 ~ 37602664 (+)
G89552 NA non-coding upstream 683699 37564974 ~ 37565215 (+)
G89607 NA non-coding downstream 132452 38382692 ~ 38382955 (+)
G89608 NA non-coding downstream 168681 38418921 ~ 38419128 (+)
G89606 NA non-coding downstream 174170 38424410 ~ 38425293 (+)
G89619 NA non-coding downstream 178183 38428423 ~ 38429446 (+)
G89621 NA non-coding downstream 183028 38433268 ~ 38433484 (+)
G89578 NA other upstream 97865 38121257 ~ 38151049 (+)
AMCG00021900 NA other upstream 1589670 36650232 ~ 36659244 (+)
G89299 NA other upstream 2281530 35964571 ~ 35967384 (+)
G89142 NA other upstream 2985377 35211133 ~ 35263537 (+)
AMCG00021881 LOC107748698,LOC102792383,LOC101481807,LOC108256925,LOC106919167,LOC108434168 other upstream 3171824 34926553 ~ 35077090 (+)
G89632 NA other downstream 567632 38817872 ~ 38822685 (+)
G89728 NA other downstream 1150284 39400524 ~ 39408261 (+)

Expression


Co-expression Network