XLOC_006525


Basic Information

Item Value
gene id XLOC_006525
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 15456676 ~ 15457624 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00013469
aatcaaactgcagcagcacgccacgaggttttgctcagacttttgggacgtttggaattgctccgtcttgtcaccatgtaacacatagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaaggaaataatgtgttattttgctgtttgagtataggcaggcgcagtgagtagc

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0050794 regulation of cellular process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko03070 Bacterial secretion system
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00013469 True 249 lncRNA 0.48 2 15456676 15457624

Neighbor

gene id symbol gene type direction distance location
XLOC_006524 rab11fip5a coding downstream 314396 15091264 ~ 15142280 (-)
XLOC_006523 sfxn5a coding downstream 374652 15020822 ~ 15082024 (-)
XLOC_006522 NA coding downstream 475096 14950795 ~ 14981580 (-)
XLOC_006521 cdc25b coding downstream 527440 14915344 ~ 14929236 (-)
XLOC_006520 ap5s1 coding downstream 547677 14902318 ~ 14908999 (-)
XLOC_006526 BX511166.1 coding upstream 117513 15575137 ~ 15580152 (-)
XLOC_006527 ckba coding upstream 224451 15682075 ~ 15702736 (-)
XLOC_006528 bag5 coding upstream 304654 15762278 ~ 15799391 (-)
XLOC_006529 si:ch211-57f7.7 coding upstream 396053 15853677 ~ 15865335 (-)
XLOC_006530 ttl coding upstream 460825 15918449 ~ 15929402 (-)
XLOC_006471 BX537274.2 misc downstream 5191771 10264741 ~ 10264905 (-)
XLOC_006338 rn7sk misc downstream 14630451 825904 ~ 826225 (-)
XLOC_006519 NA non-coding downstream 923422 14532720 ~ 14533254 (-)
XLOC_006518 AL928929.1 non-coding downstream 1072138 14384421 ~ 14384538 (-)
XLOC_006516 NA non-coding downstream 1441496 14013185 ~ 14015180 (-)
XLOC_006514 NA non-coding downstream 1716116 13737542 ~ 13740560 (-)
XLOC_006536 NA non-coding upstream 803027 16260651 ~ 16261573 (-)
XLOC_006537 BX323467.1 non-coding upstream 850143 16307767 ~ 16307883 (-)
XLOC_006538 NA non-coding upstream 1410756 16868380 ~ 16879070 (-)
XLOC_006540 NA non-coding upstream 2036673 17494297 ~ 17530536 (-)

Expression


Co-expression Network