G68678


Basic Information

Item Value
gene id G68678
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 8222587 ~ 8222817 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU101562
ACCATTTCAAACACCTTTCAGCTACACTTATTGAACACACAAGAGCACGCTTGAGCCACGGCTCCGTATCACTCTCACGCCGATGCGTCCACAGGAGACTCATTCATCAGCCTGCGTGTTACTTTTAGTGGATCAAAGCGATCGATATCAGACGATTCTAAGCCATTATCAGTTACAATCATTGATTAGAAATGTGATTCCGATGTACTTTTCTGATCAGGGCATGTAAAC

Function

GO:

id name namespace
GO:0009410 response to xenobiotic stimulus biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU101562 True 231 lncRNA 0.44 1 8222587 8222817

Neighbor

gene id symbol gene type direction distance location
LOC122351256 LOC107668397,LOC107593014,LOC107752910 coding upstream 19651 8176835 ~ 8202936 (+)
fzd7a fzd7,fzd7a,LOC107751502,LOC107752890,LOC107668396 coding upstream 49624 8170166 ~ 8172963 (+)
raph1a raph1,raph1a,LOC107752894,LOC107592998,LOC107688759,LOC107668371 coding upstream 204700 7962407 ~ 8017887 (+)
fer1l6 fer1l6,LOC107752896,LOC107596537,LOC107738098 coding upstream 284085 7921678 ~ 7938502 (+)
prkag3b prkag3b,LOC107738101,LOC107596559,LOC107752899,LOC107668376 coding upstream 302025 7908087 ~ 7920562 (+)
ankzf1 LOC107677786,LOC107749886 coding downstream 120405 8343222 ~ 8349525 (+)
myo10l3 LOC107677785,LOC107749884,LOC107752883,LOC107668373 coding downstream 143845 8366662 ~ 8426929 (+)
pttg1ipb pttg1ipb,LOC107749904,LOC107677780,LOC107596555 coding downstream 205029 8427846 ~ 8430614 (+)
tspearb tspearb,LOC107749903,LOC107677782,LOC107752923,LOC107593006,LOC107668351 coding downstream 219543 8442360 ~ 8452673 (+)
tra2b LOC107668395,LOC107677789,LOC107592988,LOC107749892 coding downstream 230787 8453604 ~ 8459325 (+)
G68668 NA non-coding upstream 16624 8203853 ~ 8205963 (+)
G68446 NA non-coding upstream 368309 7853481 ~ 7854278 (+)
G68435 NA non-coding upstream 886228 7335491 ~ 7336359 (+)
G68397 desma,LOC107688742,LOC107602901,LOC107716787 non-coding upstream 921092 7280767 ~ 7301495 (+)
G68424 NA non-coding upstream 958874 7262541 ~ 7263713 (+)
LOC122351403 NA non-coding downstream 377907 8600724 ~ 8614984 (+)
G68808 NA non-coding downstream 603395 8826212 ~ 8827046 (+)
LOC122352063 NA non-coding downstream 636656 8859473 ~ 8860379 (+)
G68879 asic4a,asic4,LOC107672268,LOC107663852,LOC107560474,LOC107749871,LOC107571863 non-coding downstream 824643 9047460 ~ 9078537 (+)
G68880 NA non-coding downstream 840303 9063120 ~ 9064676 (+)
LOC122351907 LOC107670338,LOC107721263 other upstream 2249464 5962884 ~ 5973123 (+)
G68097 LOC107730457,LOC107670341,LOC107549918,LOC100537317,LOC107752618 other upstream 2336834 5883927 ~ 5885753 (+)
trnam-cau_112 NA other upstream 2765058 5457458 ~ 5457529 (+)
trnar-ccu_65 NA other upstream 2765324 5457191 ~ 5457263 (+)
trnam-cau_111 NA other upstream 2765744 5456772 ~ 5456843 (+)
si:ch211-167j6.3 NA other downstream 118478 8341295 ~ 8342751 (+)
sumo3b sumo3b,LOC107668404,LOC107596521,LOC107749883,LOC103392195 other downstream 208294 8431111 ~ 8433483 (+)
igf2bp2a igf2bp2a,LOC107749880,LOC107668393 other downstream 237927 8460744 ~ 8506143 (+)
cryba2b cryba2b,LOC107749902,LOC107562110,LOC107663929,LOC107566327,LOC107560461,LOC107672280 other downstream 640570 8863387 ~ 8866305 (+)
fev fev,LOC107749901,LOC107562104,LOC107663906,LOC107672289,LOC106581833 other downstream 644280 8867097 ~ 8871633 (+)

Expression


Co-expression Network