G68879 (asic4a,asic4,LOC107672268,LOC107663852,LOC107560474,LOC107749871,LOC107571863)


Basic Information

Item Value
gene id G68879
gene name asic4a,asic4,LOC107672268,LOC107663852,LOC107560474,LOC107749871,LOC107571863
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 9047460 ~ 9078537 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU101845
CTGTAAAATCTTCGGCCGAGCAGTTCTGCCCACTGAAGTTGCAGCTCTTTAGCATCTCTTCCAGCTGGTGACCCGTCCGGTTGAAGATGTCCTGCATGTCCGGCGCCGGATACTCCAAATCGGTGGGCTTGTGGCCATCCTTGTTTTTTGGGGGCAAGCCGGTCAGGTTGGCCAGGTGGTAGATGTCGGCGTCAGTAAGAGCGGAAAAGCGGAAACGGTTGATGTTGCAGATGGTCACGGCGGGGAACACCATCTCCGGGGTGGCCTCCTCATTCAGTGCCGTGACATGAGGATGCTCCAGGTAGGAGATGGCACACTTTGCCGCCTGGTATAGAAAGAGAGCCAGGGACACCAGGAACGCAAGAGCCCAGAGGGTCTGTCTGACGCCCAGCCGGCCCGACACAAAGATGTGGTTAATCCCATGGAGCGAGCACGCATTGGCGAAGCCGGCCAGGTCTTTGGCTGGGGGGCTGCAGCTCTCCTCGATCAGGCTCTCCTTGTCCCCATCCTGGTTGCCTTTCTGCTTCTCATCCTCCTCTGCAAATTTGATTTTGCAAACAAATTCGATCGGCATGTGGGCAGCCAGGTCTGCGTTTGGGATGCTTGGATAACAGCTTGGAGCCCCAACTCTTGCCAT

Function

symbol description
asic4a Enables ligand-gated sodium channel activity. Predicted to be involved in sodium ion transmembrane transport. Predicted to act upstream of or within sodium ion transport. Is integral component of plasma membrane. Is expressed in gill; retinal ganglion cell layer; and retinal photoreceptor layer. Orthologous to human ASIC4 (acid sensing ion channel subunit family member 4).
asic4 Predicted to enable ligand-gated sodium channel activity. Predicted to be involved in sodium ion transmembrane transport. Predicted to act upstream of or within behavioral fear response. Predicted to be integral component of plasma membrane.

NR:

description
PREDICTED: acid-sensing ion channel 4-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU101845 True 637 lncRNA 0.57 2 9047460 9078537

Neighbor

gene id symbol gene type direction distance location
chpfa chpfa,LOC107749870,LOC107663851,LOC107571864,LOC107672254,LOC107743933 coding upstream 70461 8966861 ~ 8976999 (+)
umps umps coding upstream 215558 8827690 ~ 8831902 (+)
itgav itgav,LOC107663834,LOC107672211,LOC107752904 coding upstream 223069 8801297 ~ 8824391 (+)
zc3h15 zc3h15,LOC107562108,LOC107663835,LOC107749874,LOC107752875,LOC107672221 coding upstream 249525 8793317 ~ 8797935 (+)
znf804a znf804a,LOC107562107,LOC107749875,LOC107752876,LOC107672201,LOC107663892,LOC107560471 coding upstream 345165 8651167 ~ 8702295 (+)
hnmt hnmt,LOC107751616,LOC107720324,LOC107663827,LOC107658225,LOC107577691,LOC107558040 coding downstream 491863 9570400 ~ 9574754 (+)
spopla spopla,LOC107751611,LOC107556446,LOC107720326,LOC107558043,LOC107658226,LOC107663914 coding downstream 523449 9601986 ~ 9610746 (+)
LOC122351877 ugt1a7,ugt1a5,ugt1a6,ugt1a2,LOC107663839,LOC107556441,LOC107732349,LOC107658228,LOC107658227,LOC107558044,LOC107720327 coding downstream 550077 9628614 ~ 9652625 (+)
LOC122351880 ugt1a4,LOC107663839,LOC107556441 coding downstream 554616 9633153 ~ 9636711 (+)
LOC122351879 LOC107558046,LOC107658227,LOC107558044,LOC107720327 coding downstream 558854 9637391 ~ 9639325 (+)
LOC122352063 NA non-coding upstream 187081 8859473 ~ 8860379 (+)
G68808 NA non-coding upstream 220414 8826212 ~ 8827046 (+)
LOC122351403 NA non-coding upstream 432476 8600724 ~ 8614984 (+)
G68678 NA non-coding upstream 824643 8222587 ~ 8222817 (+)
G68668 NA non-coding upstream 841497 8203853 ~ 8205963 (+)
G68895 NA non-coding downstream 97787 9176324 ~ 9178926 (+)
G68896 NA non-coding downstream 102214 9180751 ~ 9184568 (+)
G68897 NA non-coding downstream 102367 9180904 ~ 9194303 (+)
G68900 NA non-coding downstream 162401 9240938 ~ 9241387 (+)
G68901 NA non-coding downstream 176795 9255332 ~ 9412735 (+)
fev fev,LOC107749901,LOC107562104,LOC107663906,LOC107672289,LOC106581833 other upstream 175827 8867097 ~ 8871633 (+)
cryba2b cryba2b,LOC107749902,LOC107562110,LOC107663929,LOC107566327,LOC107560461,LOC107672280 other upstream 181155 8863387 ~ 8866305 (+)
igf2bp2a igf2bp2a,LOC107749880,LOC107668393 other upstream 541317 8460744 ~ 8506143 (+)
sumo3b sumo3b,LOC107668404,LOC107596521,LOC107749883,LOC103392195 other upstream 613977 8431111 ~ 8433483 (+)
si:ch211-167j6.3 NA other upstream 704709 8341295 ~ 8342751 (+)
si:ch1073-416j23.1 si:ch1073-416j23.1,LOC107749868,LOC107663920,LOC107556448 other downstream 64055 9142592 ~ 9150093 (+)
LOC122351827 LOC107568346,LOC107676221,LOC566927,LOC107706103,LOC107706102,LOC108412955 other downstream 77508 9156045 ~ 9160821 (+)
thsd7ba thsd7b,thsd7ba,LOC107663893,LOC107751610,LOC107720322,LOC107658187,LOC107658188,LOC107558036 other downstream 364588 9443125 ~ 9566997 (+)
piga piga,LOC107748211,LOC107555234,LOC107663925,LOC107655498,LOC107600385,LOC107720146 other downstream 1013813 10092350 ~ 10113356 (+)
si:dkey-100n23.5 LOC107748207,LOC107555230,LOC107720121,LOC107655523 other downstream 1088799 10167336 ~ 10174783 (+)

Expression


Co-expression Network