G69888 (col6a3,LOC107670696,LOC107567775,LOC107739950)



Basic Information


Item Value
gene id G69888
gene name col6a3,LOC107670696,LOC107567775,LOC107739950
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 13302403 ~ 13327413 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU103390
CAGTGGCTGTTGGTAAAGGTGGAGTGATGGGAACTGGAACAGCCTGGACAGAGGCCAGCAGCTGCTCTTGGACTTTTGGAAGCTCACTGAAGTCGGAGACGGTAAGAGCATAATTGGGGTCGTATGAAATTCTCTGCATTTCTCTGCTATCAGAGCCCCTCGATCCGATTCCAAAGGTCAAAACGCCAAGCTCTTTCAGAGAAGAGGCTGCTGCATCAACACTGTCAGATGACCTTCCACTGCTAAGCAAAATCAATATCTGCGGCACACCCTCCAGCTGCCTGCTGCCAGAGGAGGCGGCAAAGACATTGTCTCTGACGTACTGGAGACCCGCCCCCGTGTAGAGGGGTCTGCCTCCTTTGTGCCTCAGACCTCTGACACCTTCAAGAATGTCTTCCTTTGTCGTGTACGTGTTAAGATAGAAATGGGCCTCTGCTTCTCTGCTGTACTGGACCACAGAAACGCGATCTCTGTTCTCAGCTATGTCCAATCTCTCCACCATTCTTTGCACAAACTCTTTCATTGCTGGGAACCCATTGCGAGTGCCATCGGATCCATCCAGCAGGAAGACAACATCTCTCCTCTGTCTACGGCCCTCAGCTAAGA

Function


symbol description
col6a3 Predicted to enable serine-type endopeptidase inhibitor activity. Acts upstream of or within axon extension and motor neuron axon guidance. Predicted to be located in extracellular region. Predicted to be part of collagen trimer. Predicted to be active in collagen-containing extracellular matrix and extracellular space. Is expressed in head. Human ortholog(s) of this gene implicated in Ullrich congenital muscular dystrophy; dystonia 27; and muscular dystrophy. Orthologous to human COL6A3 (collagen type VI alpha 3 chain).

NR:

description
PREDICTED: collagen alpha-3(VI) chain-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU103390 True 606 lncRNA 0.52 3 13302403 13327413

Neighbor


gene id symbol gene type direction distance location
mlphb mlphb,LOC107739953,LOC107670700,LOC107695586,LOC107555071,LOC107571729 coding downstream 50744 13236681 ~ 13251659 (-)
prlh NA coding downstream 66219 13235407 ~ 13236184 (-)
lrrfip1a lrrfip1a,LOC107670703,LOC107571722,LOC107725241,LOC107601083,LOC107739944,LOC107695587 coding downstream 91337 13179504 ~ 13211066 (-)
maip1 NA coding downstream 125869 13173919 ~ 13176534 (-)
pgap1 pgap1,LOC107571728,LOC107601081,LOC107670709 coding downstream 128619 13160284 ~ 13173784 (-)
cops8 cops8,trim63b,LOC107723689,LOC107685920,LOC107725246,LOC107695583,LOC106581673 coding upstream 27338 13354751 ~ 13362915 (-)
ints6 ints6,LOC107567782,LOC107685346,LOC107723679,LOC107695579,LOC107725253 coding upstream 72839 13400252 ~ 13410399 (-)
dhrs12 dhrs12,LOC107685263,LOC107723690,LOC107725249,LOC107695571,LOC107555069,LOC107567773 coding upstream 92602 13420015 ~ 13424845 (-)
parp14rs1 si:ch211-219a4.3,LOC107725230,LOC107695575,LOC107555066,LOC107555021,LOC107579587,LOC107754848 coding upstream 106552 13433965 ~ 13444172 (-)
faima faima,faim,LOC107723686,LOC107686598,LOC107725233,LOC107695570,LOC108266416 coding upstream 122457 13449870 ~ 13454850 (-)
LOC122351987 NA non-coding downstream 70193 13228154 ~ 13232210 (-)
G69762 NA non-coding downstream 264950 13035956 ~ 13037453 (-)
LOC122351847 NA non-coding downstream 513269 12787115 ~ 12789134 (-)
G69738 NA non-coding downstream 528551 12773441 ~ 12773852 (-)
G69733 NA non-coding downstream 570660 12731041 ~ 12731743 (-)
G69953 NA non-coding upstream 84399 13411812 ~ 13412439 (-)
G70027 NA non-coding upstream 347305 13674718 ~ 13675514 (-)
G70033 NA non-coding upstream 351967 13679380 ~ 13682139 (-)
G70263 LOC107723691,LOC107555352,LOC107725250,LOC107555050 non-coding upstream 488298 13815711 ~ 13816743 (-)
G70271 NA non-coding upstream 507833 13835246 ~ 13835699 (-)
G69757 NA other downstream 316425 12985124 ~ 12985978 (-)
LOC122352189 NA other downstream 564232 12738044 ~ 12738171 (-)
LOC122351186 adcy5,LOC107555914,LOC107660638,LOC107596066,LOC107661140,LOC106586396,LOC107745452,LOC107668560,LOC107695824,LOC107716189,LOC107568450,LOC108433131 other downstream 581713 12707976 ~ 12720690 (-)
lrch1 lrch1,LOC107709425,LOC107601076,LOC107673127,LOC107724026 other downstream 719978 12518284 ~ 12582425 (-)
G69650 NA other downstream 878957 12422429 ~ 12423446 (-)
gypc gypc,LOC107723681,LOC107725252,LOC107555063,LOC107567781,LOC107684853,LOC107695565 other upstream 145722 13473135 ~ 13495667 (-)
tmem163a tmem163a,LOC107658221,LOC107725256,LOC107684456,LOC107555363,LOC106586306,LOC106582396 other upstream 314890 13642303 ~ 13673807 (-)
G70261 LOC107682829,LOC107723691,LOC107555352,LOC107658202,LOC107555050 other upstream 480409 13807822 ~ 13813327 (-)
rif1 LOC107658288,LOC107555351,LOC107658286,LOC107725242,LOC107680950 other upstream 552157 13879570 ~ 13912943 (-)
G70294 NA other upstream 610846 13938259 ~ 13939868 (-)

Expression



Co-expression Network