G69953


Basic Information

Item Value
gene id G69953
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 13411812 ~ 13412439 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU103479
CGGCTTAAATGCGTGCTGACCTGTCTTGAGATACGCTGATAACCCCGTCCTCCTTGGGGATGATCACAGCCGTATTCACCACATCTTGAAAACCCTCGATCTTACTCAGCAGGACGGGTTTTCGGGTCTGCGGACGGGGATGGATCTCTGCCGCCATGGCGCTGTAGTTCCTCCGTCACCCGAGTCCTCTCTCGGCAGCATAACACGCCGAGCGCAGGTCGACTATCAGACCTGCAGTCGGTCAGGGATGCTGCGGGTCAGCTGATGAAGTCTCCCGGCCTGCGCTGGTCACGCTCAAACACGATCTCTATGCCATGGCCCCCGACGCCGCGCGCGCCGTCCTCTCGTTCTCCACGTACACGGACGATCCGA

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065009 regulation of molecular function biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010468 regulation of gene expression biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0051090 regulation of DNA-binding transcription factor activity biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU103479 True 372 lncRNA 0.60 2 13411812 13412439

Neighbor

gene id symbol gene type direction distance location
ints6 ints6,LOC107567782,LOC107685346,LOC107723679,LOC107695579,LOC107725253 coding downstream 1413 13400252 ~ 13410399 (-)
cops8 cops8,trim63b,LOC107723689,LOC107685920,LOC107725246,LOC107695583,LOC106581673 coding downstream 48897 13354751 ~ 13362915 (-)
mlphb mlphb,LOC107739953,LOC107670700,LOC107695586,LOC107555071,LOC107571729 coding downstream 160153 13236681 ~ 13251659 (-)
prlh NA coding downstream 175628 13235407 ~ 13236184 (-)
lrrfip1a lrrfip1a,LOC107670703,LOC107571722,LOC107725241,LOC107601083,LOC107739944,LOC107695587 coding downstream 200746 13179504 ~ 13211066 (-)
dhrs12 dhrs12,LOC107685263,LOC107723690,LOC107725249,LOC107695571,LOC107555069,LOC107567773 coding upstream 7576 13420015 ~ 13424845 (-)
parp14rs1 si:ch211-219a4.3,LOC107725230,LOC107695575,LOC107555066,LOC107555021,LOC107579587,LOC107754848 coding upstream 21526 13433965 ~ 13444172 (-)
faima faima,faim,LOC107723686,LOC107686598,LOC107725233,LOC107695570,LOC108266416 coding upstream 37431 13449870 ~ 13454850 (-)
LOC122351673 tas2r60,LOC107686069,LOC107567768,LOC107658204,LOC107555019,LOC107723647 coding upstream 101163 13513602 ~ 13515484 (-)
cntnap5a cntnap5a,LOC107723682,LOC107567780,LOC107684760,LOC107658203,LOC107725209,LOC108425961 coding upstream 103249 13515688 ~ 13574954 (-)
G69888 col6a3,LOC107670696,LOC107567775,LOC107739950 non-coding downstream 84399 13302403 ~ 13327413 (-)
G69896 col6a3,LOC107567775,LOC107685998 non-coding downstream 86143 13310873 ~ 13325669 (-)
LOC122351987 NA non-coding downstream 179602 13228154 ~ 13232210 (-)
G69762 NA non-coding downstream 374359 13035956 ~ 13037453 (-)
LOC122351847 NA non-coding downstream 622678 12787115 ~ 12789134 (-)
G70027 NA non-coding upstream 262279 13674718 ~ 13675514 (-)
G70033 NA non-coding upstream 266941 13679380 ~ 13682139 (-)
G70263 LOC107723691,LOC107555352,LOC107725250,LOC107555050 non-coding upstream 403272 13815711 ~ 13816743 (-)
G70271 NA non-coding upstream 422807 13835246 ~ 13835699 (-)
G70272 NA non-coding upstream 424871 13837310 ~ 13837600 (-)
G69757 NA other downstream 425834 12985124 ~ 12985978 (-)
LOC122352189 NA other downstream 673641 12738044 ~ 12738171 (-)
LOC122351186 adcy5,LOC107555914,LOC107660638,LOC107596066,LOC107661140,LOC106586396,LOC107745452,LOC107668560,LOC107695824,LOC107716189,LOC107568450,LOC108433131 other downstream 691122 12707976 ~ 12720690 (-)
lrch1 lrch1,LOC107709425,LOC107601076,LOC107673127,LOC107724026 other downstream 829387 12518284 ~ 12582425 (-)
G69650 NA other downstream 988366 12422429 ~ 12423446 (-)
gypc gypc,LOC107723681,LOC107725252,LOC107555063,LOC107567781,LOC107684853,LOC107695565 other upstream 60696 13473135 ~ 13495667 (-)
tmem163a tmem163a,LOC107658221,LOC107725256,LOC107684456,LOC107555363,LOC106586306,LOC106582396 other upstream 229864 13642303 ~ 13673807 (-)
G70261 LOC107682829,LOC107723691,LOC107555352,LOC107658202,LOC107555050 other upstream 395383 13807822 ~ 13813327 (-)
rif1 LOC107658288,LOC107555351,LOC107658286,LOC107725242,LOC107680950 other upstream 467131 13879570 ~ 13912943 (-)
G70294 NA other upstream 525820 13938259 ~ 13939868 (-)

Expression


Co-expression Network