G70382



Basic Information


Item Value
gene id G70382
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 14477332 ~ 14562992 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU104117
TGAAAGGGGGGGGGGAGGAAGAAGAAAGCAGCATCCTGTAGGTCATGTTTCTGGAGAAAACCTAAACTCCTCAGGGTCTTTGGGAAGACTGATCTGAATCAGCATAATCCCACCAATATTAATATCCATCCCGACATCATCTCTTAGCAGATTGGGATCAGTGTGTTTAAAGGGAGAGTGACAGGGTGTGACATGGAAAGCAGCTCATCGGTGATGCACAGGGTGTCTGGACAGCATAGTAAGAAGTCTTCAGTGCATCTGCATCTAGACGCCCTCCTCTTCGTGCTGGTTGTCTTTATAAATATCTCTGACCAGCAGCACTCGAGTCAGGAGCCTAGCCAAAGCGCTCTTCTCTAGAGGCGTCGAGCTGAACCACAGTGGACTGTCCGAGGAAGCAGAGACCTCTGGCTTCATGTACAAAAAATCTTTCCTCTGTCTCACA

Function


GO: NA

KEGG:

id description
ko00052 Galactose metabolism
ko00500 Starch and sucrose metabolism

RNA


RNA id representative length rna type GC content exon number start site end site
TU104117 True 442 lncRNA 0.49 2 14477332 14562992
Loading

Neighbor


gene id symbol gene type direction distance location
arhgef7a arhgef7a,LOC107712280,LOC107668898,LOC107569023,LOC107597388 coding downstream 50526 14408577 ~ 14426806 (-)
sox1a sox1a,LOC107569013,LOC107668909,LOC107658211,LOC107597426,LOC107724510 coding downstream 136709 14338698 ~ 14340623 (-)
rev1 rev1,LOC107658260,LOC107568994,LOC107668902 coding downstream 171048 14290849 ~ 14306284 (-)
txndc9 txndc9,LOC107568936,LOC107724502,LOC107668903,LOC107658261,LOC107705160,LOC107597391 coding downstream 187104 14287287 ~ 14290228 (-)
zgc:162944 zgc:162944,LOC107724454,LOC107597427,LOC107658212,LOC107705163,LOC108424409,LOC103034916,LOC108266838 coding downstream 191802 14283602 ~ 14285530 (-)
LOC122351989 LOC107668905,LOC107569207,LOC107724507,LOC101884374 coding upstream 6818 14569810 ~ 14573059 (-)
ska3 LOC107724453,LOC107668865,LOC107569224,LOC107597424,LOC107577924 coding upstream 11803 14574795 ~ 14578272 (-)
hcn5 si:rp71-68n21.12,LOC107724451,LOC107712254,LOC107658208,LOC107668864,LOC107569239,LOC108270784 coding upstream 16291 14579283 ~ 14585833 (-)
pla1a LOC107724500,LOC107668900,LOC107569279,LOC107712265,LOC107597373 coding upstream 32402 14595394 ~ 14602797 (-)
hsd3b1 hsd3b1,LOC107569293,LOC107658243,LOC107712267 coding upstream 41827 14604819 ~ 14607004 (-)
G70332 LOC107724468 non-coding downstream 230004 14244287 ~ 14247328 (-)
LOC122352120 NA non-coding downstream 288331 14173817 ~ 14189001 (-)
G70309 NA non-coding downstream 552496 13924616 ~ 13924836 (-)
G70308 NA non-coding downstream 553228 13923749 ~ 13924104 (-)
G70306 NA non-coding downstream 598920 13878124 ~ 13878412 (-)
G70393 NA non-coding upstream 26866 14589858 ~ 14590275 (-)
G70396 NA non-coding upstream 31271 14594263 ~ 14595342 (-)
G70438 LOC107600383,LOC107655530,LOC107720111 non-coding upstream 353808 14916800 ~ 14918840 (-)
LOC122352110 NA non-coding upstream 374132 14937124 ~ 14942863 (-)
G70494 LOC107740907,LOC107668887,LOC107600382,LOC107720110 non-coding upstream 412420 14975412 ~ 14981853 (-)
LOC122351495 NA other downstream 104658 14359646 ~ 14372674 (-)
G70317 NA other downstream 223556 14196479 ~ 14253776 (-)
G70294 NA other downstream 537464 13938259 ~ 13939868 (-)
rif1 LOC107658288,LOC107555351,LOC107658286,LOC107725242,LOC107680950 other downstream 564389 13879570 ~ 13912943 (-)
G70261 LOC107682829,LOC107723691,LOC107555352,LOC107658202,LOC107555050 other downstream 664005 13807822 ~ 13813327 (-)
G70549 NA other upstream 740111 15303103 ~ 15305975 (-)
tmtc4 tmtc4,LOC107748611,LOC107569561,LOC107681320,LOC107600375,LOC107694590 other upstream 826226 15389218 ~ 15399437 (-)
G70663 plcl1,LOC107731752,LOC107569711,LOC107690606,LOC107659890,LOC107595846,LOC107719808 other upstream 1208429 15771421 ~ 15771864 (-)
dcaf6 LOC107673675,LOC107695452,LOC107748145,LOC107595867 other upstream 2157812 16720804 ~ 16746222 (-)
G70986 pou2f1b,LOC107748141 other upstream 2254148 16817140 ~ 16823775 (-)

Expression


G70382 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G70382 Expression in each Bioproject

Bar chart with 2 bars.
G70382 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network