G70663 (plcl1,LOC107731752,LOC107569711,LOC107690606,LOC107659890,LOC107595846,LOC107719808)


Basic Information

Item Value
gene id G70663
gene name plcl1,LOC107731752,LOC107569711,LOC107690606,LOC107659890,LOC107595846,LOC107719808
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 15771421 ~ 15771864 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU104521
ACCAATGGAACCAGGATGAGACAACAGGTACCTCAACCCTGTCACCCAGATGTTGGCTACATCCGCAGAAAGTGCAACCAGGTCCAGGGACTGATACTCGTCACCGTGAATGATGGAGAAGGCTGCTTCTTCAGCAAGGTGCTCCGATGGACCATTGTGGAGAAAGGTCTCTGTGCTTTTCCCTGTGCGGACCTCACGAATAGCAGAGATATCAAGTCGAGCTCGGTCACCATCTTTCTTGGAGGGTTCCCAACGGAGGCAGGCCAGCTCTGGATCTAGAGTGTAGAATCTAGAGTAGATGCGCGAGTTGGGTCGCACCTTCTTTAGCTCGCAGCCACCCTGCATGAAGGCCAGGCAGTCTGCAGCACTGCTCACTTTCTTTTCAGATGGCATACTGCTGAAGGAAACAGTTTTCTTTCTCCCACCACTGACCTTGGCCACTGA

Function

symbol description
plcl1 Predicted to enable GABA receptor binding activity; inositol 1,4,5 trisphosphate binding activity; and phosphatidylinositol phospholipase C activity. Predicted to be involved in phosphatidylinositol-mediated signaling. Predicted to act upstream of or within intracellular signal transduction; lipid catabolic process; and regulation of GABAergic synaptic transmission. Is expressed in hindbrain; lateral line nerve; and spinal cord. Orthologous to human PLCL1 (phospholipase C like 1 (inactive)).

NR:

description
PREDICTED: inactive phospholipase C-like protein 1 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU104521 True 444 TUCP 0.53 1 15771421 15771864

Neighbor

gene id symbol gene type direction distance location
rftn2 rftn2,LOC107690607,LOC107731757,LOC107719806,LOC107595849,LOC107569700 coding downstream 42621 15716322 ~ 15728800 (-)
hspd1 hspd1,LOC107569661,LOC107690611,LOC107659893,LOC107595848 coding downstream 63757 15701915 ~ 15707664 (-)
sf3b1 sf3b1,LOC107731751,LOC107569635,LOC107659892,LOC107719800,LOC107595847,LOC107690614 coding downstream 78806 15682700 ~ 15692615 (-)
ankrd44 ankrd44,LOC107719801,LOC107659898,LOC107595853 coding downstream 90582 15657514 ~ 15680839 (-)
fgf14 fgf14,LOC107569606,LOC107600372,LOC107681314,LOC107690615 coding downstream 144630 15525358 ~ 15626791 (-)
satb2 satb2,LOC107731767,LOC107690605,LOC107569722,LOC107595845,LOC107659884,LOC107719815 coding upstream 62675 15834539 ~ 15876097 (-)
dnajb11 dnajb11,LOC107595843,LOC107690604,LOC107719809,LOC107659888,LOC107731764,LOC107569729 coding upstream 122258 15894122 ~ 15899152 (-)
LOC122351158 LOC107690624,LOC107595883 coding upstream 130483 15902347 ~ 15904183 (-)
LOC122351156 LOC107731741,LOC107569997 coding upstream 134164 15906028 ~ 15907567 (-)
ercc1 ercc1,LOC107570013 coding upstream 137420 15909284 ~ 15913570 (-)
G70660 NA non-coding downstream 8752 15762383 ~ 15762669 (-)
G70633 pikfyve,LOC107719798,LOC107681306,LOC107731754 non-coding downstream 127145 15642259 ~ 15644276 (-)
LOC122351574 NA non-coding downstream 132985 15628883 ~ 15638436 (-)
G70581 NA non-coding downstream 349844 15418999 ~ 15421577 (-)
G70503 zic2a,LOC107600377,LOC107694587,LOC107569553,LOC107681317 non-coding downstream 495580 15013357 ~ 15275841 (-)
LOC122352066 NA non-coding upstream 176249 15948113 ~ 15953976 (-)
G70894 NA non-coding upstream 346418 16118282 ~ 16120319 (-)
LOC122351188 NA non-coding upstream 833503 16605367 ~ 16631420 (-)
G70955 NA non-coding upstream 838406 16610270 ~ 16610561 (-)
G70956 NA non-coding upstream 841253 16613117 ~ 16613424 (-)
tmtc4 tmtc4,LOC107748611,LOC107569561,LOC107681320,LOC107600375,LOC107694590 other downstream 371984 15389218 ~ 15399437 (-)
G70549 NA other downstream 465446 15303103 ~ 15305975 (-)
LOC122351495 NA other downstream 1398747 14359646 ~ 14372674 (-)
G70317 NA other downstream 1517645 14196479 ~ 14253776 (-)
G70294 NA other downstream 1831553 13938259 ~ 13939868 (-)
dcaf6 LOC107673675,LOC107695452,LOC107748145,LOC107595867 other upstream 948940 16720804 ~ 16746222 (-)
G70986 pou2f1b,LOC107748141 other upstream 1045276 16817140 ~ 16823775 (-)
cd247l cd247l,LOC107595825,LOC107673686,LOC107756738,LOC107597501,LOC107748195,LOC107695491 other upstream 1114889 16886753 ~ 16889547 (-)
G71118 erbb4,LOC107660610,LOC107721020,LOC107741926,LOC103360983,LOC106519748,LOC103461563 other upstream 1464008 17235872 ~ 17255491 (-)
ncam2 ncam2,LOC107756756,LOC108426076,LOC107595857,LOC107673712,LOC107748174 other upstream 1592323 17364187 ~ 17521560 (-)

Expression


Co-expression Network