cd247l (cd247l,LOC107595825,LOC107673686,LOC107756738,LOC107597501,LOC107748195,LOC107695491)


Basic Information

Item Value
gene id cd247l
gene name cd247l,LOC107595825,LOC107673686,LOC107756738,LOC107597501,LOC107748195,LOC107695491
gene type misc
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 16886753 ~ 16889547 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU105039
TAACCCCAATGAGCCTGTATATACAGACTTGGATCTGCCTCAGATGAGTTCCGATTATCAGCAACTGGATAGACCGATAAGAAGACGAGAGCCAGAGACACATTATCAGGAATTGAGAGCACATACAAGCGATGAATACCAGGAAATAAGAACTAAACCTCGCAAAGGCAAGAACAAATCTAATGAGGGTCGAGCAGGGAGAAACAGGAATGCAGCCGAGGCTGTGGAGATGGAAACATTTCCCACTGATGCATTACACAATTAACACAGAGCACAAGCTCAGGAGCAACCTCTATATCTGTTAACAGATAAATTGT
>XM_043248994.1
ATGCACCATACGCCCCAagtgaaaaaaatATCCTGCGACCCCGGCCATAACCCCAATGAGCCTGTATATACAGACTTGGATCTGCCTCAGATGAGTTCCGATTATCAGCAACTGGATAGACCGATAAGAAGACGAGAGCCAGAGACACATTATCAGGAATTGAGAGCACATACAAGCGATGAATACCAGGAAATAAGAACTAAACCTCGCAAAGGCAAGAACAAATCTAATGAGGGTCGAGCAGGGAGAAACAGGAATGCAGCCGAGGCTGTGGAGATGGAAACATTTCCCACTGATGCATTACACAATTAACACAGAGCACAAGCTCAGGAGCAACCTCTATATCTGTTAACAGATAAATTGTATATCTTTGCTGAATgcatttatatcttttttttaatttgttacttCGCCTG

Function

symbol description
cd247l Predicted to enable IgE receptor activity. Predicted to act upstream of or within cell surface receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of Fc-epsilon receptor I complex. Is expressed in hematopoietic cell; liver; and pleuroperitoneal region.

NR:

description
PREDICTED: T-cell surface glycoprotein CD3 zeta chain-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU105039 False 317 lncRNA 0.44 6 16886805 16889429
XM_043248994.1 True 416 mRNA 0.43 7 16886753 16889547

Neighbor

gene id symbol gene type direction distance location
LOC122352097 me3,LOC107748144,LOC107595810,LOC107695468,LOC107756775,LOC108426042,LOC102313335 coding downstream 119568 16761873 ~ 16767185 (-)
LOC122351201 nxpe3,LOC107748146,LOC107673677,LOC107597504,LOC107695470,LOC107756776,LOC107595812 coding downstream 126581 16752003 ~ 16760172 (-)
slc35a5 LOC107748197,LOC107565955,LOC107673679,LOC107756781,LOC107695476 coding downstream 188114 16694754 ~ 16698639 (-)
dipk2b si:ch73-147f11.1,LOC107756741,LOC107695496,LOC107595885 coding downstream 302692 16579731 ~ 16584061 (-)
fundc1 fundc1,LOC107673665,LOC107748200,LOC107565940,LOC107695457,LOC107595886,LOC107756742 coding downstream 346102 16538368 ~ 16540651 (-)
grtp1b grtp1b,LOC107748194,LOC107695480,LOC107673704 coding upstream 9116 16898663 ~ 16902174 (-)
ppp2r3b ppp2r3b,LOC107673721,LOC108426065,LOC107748139,LOC107695472,LOC108266308 coding upstream 48737 16938284 ~ 16954349 (-)
LOC122352140 NA coding upstream 227470 17117017 ~ 17131427 (-)
slc25a6 slc25a6,LOC107597494,LOC108426068,LOC107595824,LOC107695486,LOC107756767,LOC108266970 coding upstream 242923 17132470 ~ 17136795 (-)
asmtl asmtl,LOC107597490,LOC107673687 coding upstream 247594 17137141 ~ 17143357 (-)
G70981 nxpe3,LOC107597504,LOC107748146,LOC107673677,LOC107695470,LOC107756776,LOC107595812 non-coding downstream 19231 16866492 ~ 16867522 (-)
G71006 NA non-coding downstream 20331 16866178 ~ 16866422 (-)
G71005 NA non-coding downstream 21164 16865278 ~ 16865589 (-)
G70991 NA non-coding downstream 57094 16827058 ~ 16829659 (-)
G70979 NA non-coding downstream 134815 16751035 ~ 16751938 (-)
G71035 NA non-coding upstream 27677 16917224 ~ 16919314 (-)
G71117 NA non-coding upstream 323329 17212876 ~ 17297150 (-)
G71131 NA non-coding upstream 449573 17339120 ~ 17339530 (-)
G71134 NA non-coding upstream 450998 17340545 ~ 17340915 (-)
LOC122352115 NA non-coding upstream 454169 17343716 ~ 17351712 (-)
G70986 pou2f1b,LOC107748141 other downstream 62978 16817140 ~ 16823775 (-)
dcaf6 LOC107673675,LOC107695452,LOC107748145,LOC107595867 other downstream 140531 16720804 ~ 16746222 (-)
G70663 plcl1,LOC107731752,LOC107569711,LOC107690606,LOC107659890,LOC107595846,LOC107719808 other downstream 1114889 15771421 ~ 15771864 (-)
tmtc4 tmtc4,LOC107748611,LOC107569561,LOC107681320,LOC107600375,LOC107694590 other downstream 1487316 15389218 ~ 15399437 (-)
G70549 NA other downstream 1580778 15303103 ~ 15305975 (-)
G71118 erbb4,LOC107660610,LOC107721020,LOC107741926,LOC103360983,LOC106519748,LOC103461563 other upstream 346325 17235872 ~ 17255491 (-)
ncam2 ncam2,LOC107756756,LOC108426076,LOC107595857,LOC107673712,LOC107748174 other upstream 474640 17364187 ~ 17521560 (-)
sema5ba sema5ba,sema5b,LOC107597557,LOC107660660,LOC107596063 other upstream 1361689 18251236 ~ 18366267 (-)
LOC122352185 NA other upstream 1680208 18569755 ~ 18569882 (-)
ankar ankar,LOC107728908,LOC107660654 other upstream 2830395 19719942 ~ 19731794 (-)

Expression


Co-expression Network