G66686


Basic Information

Item Value
gene id G66686
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 561697 ~ 564622 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU98691
tcgtgatctcgctgatgaagggatttccagacaatggtcacctgtccagagaagagaggcgtttcatctcctgcccagaaccgtgcacacatgatcactgaagaggaagtggaaagtcaaccaatcaaaatgagcttcacttttgtatccagactagatggtggatcagcacccagagattatgttcatcagagaccagaacacctagatgcgccccgtggaccaatcaccagatcctgatgcacacacgcacacgcacacactaagtcatttacactacctgacacagctgcgtttaaaattgaactggaagttaagtgctgggcgtccggtcagaggagaactgaccccaactgagtctggtttctcccaaggtttttttttt

Function

GO:

id name namespace
GO:0048732 gland development biological_process
GO:0061008 hepaticobiliary system development biological_process
GO:0001889 liver development biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU98691 True 385 lncRNA 0.48 2 561697 564622

Neighbor

gene id symbol gene type direction distance location
LOC122351407 LOC107569775 coding upstream 181673 378075 ~ 380024 (+)
LOC122351404 sema5b,sema5ba,LOC107661137,LOC107660660,LOC108261041,LOC107597557 coding upstream 422022 47876 ~ 139675 (+)
LOC122351437 NA coding downstream 240522 805144 ~ 822378 (+)
LOC122351660 NA coding downstream 335008 899630 ~ 907921 (+)
LOC122351648 LOC107686979,LOC107709150,LOC107670647 coding downstream 345409 910031 ~ 933338 (+)
LOC122351656 LOC107700959,LOC107711456,LOC107558461 coding downstream 483792 1048414 ~ 1058016 (+)
LOC122351655 LOC107700959,LOC107700956,LOC107558461,LOC107711456,LOC107733036 coding downstream 502395 1067017 ~ 1079247 (+)
G66676 NA non-coding upstream 5150 550107 ~ 556547 (+)
G66672 NA non-coding upstream 48060 513249 ~ 513637 (+)
G66658 NA non-coding upstream 144688 351696 ~ 417009 (+)
G66690 NA non-coding downstream 18885 583507 ~ 601810 (+)
G66702 NA non-coding downstream 112561 677183 ~ 678359 (+)
G66704 NA non-coding downstream 118828 683450 ~ 685283 (+)
G66707 NA non-coding downstream 154951 719573 ~ 719789 (+)
G66708 NA non-coding downstream 167869 732491 ~ 732741 (+)
G66657 NA other upstream 99668 459574 ~ 462029 (+)
G66727 fam126b,LOC107700963 other downstream 232511 797133 ~ 805009 (+)
LOC122351650 si:ch1073-55a19.2,LOC107670647,LOC107709149,LOC107686982,LOC107559216,LOC108440489,LOC107686979,LOC107709150 other downstream 294058 858680 ~ 899379 (+)
G66795 NA other downstream 562904 1127526 ~ 1134989 (+)
bpifcl bpi other downstream 1149190 1713812 ~ 1736320 (+)
LOC122351419 polr2e,polr2eb,LOC107592678,LOC107669821,LOC107599482 other downstream 2630151 3194773 ~ 3196618 (+)

Expression


Co-expression Network