G66702


Basic Information

Item Value
gene id G66702
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 677183 ~ 678359 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU98708
gacctggaatattagagttatgggaaacatacactgtgtgcgtgacagaggttaaacccatgttaaacaacctcatgggagtacaggatgccctatctgtgctaggtacgggagataaactggagaacaatcagacactgtaagcacagatgggtggcgtgactttggactatttcaattggttagagatgaatttgagcgaccttggaatgtatacttttgcctataaaacctctaatctgtgagctcactgttatctctttgctcacagacttcactgtgtgtaaaccagatcattttgttctctgcgcggagaaataaaagcaagacaaagacaaatttgctggactctttatttttcagtcttcacataattctgagttgaaaattccatgacagcttccgataaaagcgtacgctcgcgctgttgtactcactcacgcgacgtcacgcgcaccatgtacgtgaactatagtttctatggcgacgcgtgttatgacgtgaattctacacataaacactcaaacccatcgatatctgtttgttgagagatgaggcgatttcagagactttcggagattatttcctgacactgtgattttcgacgcagttcagagcgagaggagacttttattttaggacatcggaggatatttcctttgagtacagtttgaaggaagtttttttattctcttcttatttctcttcttatttctttctttttatttctctcattctttctctctttctttctttctttctttctttcttcaactaattaatttttttttatttatttactgtatttcttggagtttggagagattgtcagccgctcttatgagtgaaagacaagtctcgggccgctccagatccaggagtgctgctgtctctcaggcggctgctcaggaggttgggagacgcggctctggtgacgacgctcaggaaccgctgaccaacccaaacctgcctctgagccaagagctgcctgggtacatcgctc

Function

GO:

id name namespace
GO:0030162 regulation of proteolysis biological_process
GO:0005615 extracellular space cellular_component
GO:0061134 peptidase regulator activity molecular_function
GO:0061135 endopeptidase regulator activity molecular_function
GO:0030414 peptidase inhibitor activity molecular_function
GO:0004866 endopeptidase inhibitor activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection

RNA

RNA id representative length rna type GC content exon number start site end site
TU98708 True 1003 lncRNA 0.43 2 677183 678359

Neighbor

gene id symbol gene type direction distance location
LOC122351407 LOC107569775 coding upstream 297159 378075 ~ 380024 (+)
LOC122351404 sema5b,sema5ba,LOC107661137,LOC107660660,LOC108261041,LOC107597557 coding upstream 537508 47876 ~ 139675 (+)
LOC122351437 NA coding downstream 126785 805144 ~ 822378 (+)
LOC122351660 NA coding downstream 221271 899630 ~ 907921 (+)
LOC122351648 LOC107686979,LOC107709150,LOC107670647 coding downstream 231672 910031 ~ 933338 (+)
LOC122351656 LOC107700959,LOC107711456,LOC107558461 coding downstream 370055 1048414 ~ 1058016 (+)
LOC122351655 LOC107700959,LOC107700956,LOC107558461,LOC107711456,LOC107733036 coding downstream 388658 1067017 ~ 1079247 (+)
G66690 NA non-coding upstream 75373 583507 ~ 601810 (+)
G66686 NA non-coding upstream 112561 561697 ~ 564622 (+)
G66676 NA non-coding upstream 120636 550107 ~ 556547 (+)
G66672 NA non-coding upstream 163546 513249 ~ 513637 (+)
G66658 NA non-coding upstream 260174 351696 ~ 417009 (+)
G66704 NA non-coding downstream 5091 683450 ~ 685283 (+)
G66707 NA non-coding downstream 41214 719573 ~ 719789 (+)
G66708 NA non-coding downstream 54132 732491 ~ 732741 (+)
G66710 NA non-coding downstream 57324 735683 ~ 735946 (+)
G66712 NA non-coding downstream 62067 740426 ~ 740664 (+)
G66657 NA other upstream 215154 459574 ~ 462029 (+)
G66727 fam126b,LOC107700963 other downstream 118774 797133 ~ 805009 (+)
LOC122351650 si:ch1073-55a19.2,LOC107670647,LOC107709149,LOC107686982,LOC107559216,LOC108440489,LOC107686979,LOC107709150 other downstream 180321 858680 ~ 899379 (+)
G66795 NA other downstream 449167 1127526 ~ 1134989 (+)
bpifcl bpi other downstream 1035453 1713812 ~ 1736320 (+)
LOC122351419 polr2e,polr2eb,LOC107592678,LOC107669821,LOC107599482 other downstream 2516414 3194773 ~ 3196618 (+)

Expression


Co-expression Network