LOC122351744 (ube2e3,LOC107601610)


Basic Information

Item Value
gene id LOC122351744
gene name ube2e3,LOC107601610
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 21897185 ~ 21907713 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043249016.1
TCTTCCGGCTCCATTTCAACTGGATTTTTAACACTCCTAACCACCCCAGATCAGGACAGGACCGCGTCTAAGGTGGAAAATGTCCAGTGAAAGACAACGGTCAGATGATGAAAGTCCCAGCACCAGCAGCGGCAGTTCCGATGCGGATCAGAGAGATCCTCCGGTGCAGAACCAGAAGAACAAGAGGAGCGAAAACAACCCACGCCTCCCACAACAGCAGAAGAAATCCACCAAACTGTCCAGCAAAACAACAGCCAAATTATCCTCCAGCGCGAAGAGAATCCAGAAAGAGCTTGCAGAAATCACTCTGGATCCTCCACCCAACTGCAGCATGACTCAAGGGAAAAATGGTTCTAGCGATTCACTTAAAGACATTCAAATGCTTCCCCCACGTTCAGAGAATGTCCTGCAGACAGTCTCGCAGTCATCACAAGGCACCCGTCTTTCACACGAAACAGAACAGAAACGCTCGGGGATGGTAGGGCAGTCATTGCCTTCCGGCGACTGGAACTGCAGACATTACTCCCATTGTGTCAGCTCTCAAAGAGGTGGAATGGTCTGA

Function

symbol description
ube2e3 Predicted to enable ubiquitin conjugating enzyme activity. Predicted to be involved in protein K11-linked ubiquitination; protein K48-linked ubiquitination; and protein K63-linked ubiquitination. Predicted to be active in nucleus. Orthologous to human UBE2E3 (ubiquitin conjugating enzyme E2 E3).

NR:

description
PREDICTED: ubiquitin-conjugating enzyme E2 E3

GO:

id name namespace
GO:0016881 acid-amino acid ligase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043249016.1 True 562 mRNA 0.50 6 21897185 21907713

Neighbor

gene id symbol gene type direction distance location
LOC122351560 ttn,LOC107657509,LOC107714399,LOC108435065 coding downstream 1138 21744043 ~ 21896047 (-)
LOC122351741 LOC107704498,LOC107549376 coding downstream 726410 21168939 ~ 21170775 (-)
LOC122351738 ttnb,LOC107698997,LOC107714355,LOC107657493,LOC107601612,LOC107716993,LOC107562704 coding downstream 1126032 20769745 ~ 20771153 (-)
LOC122351733 ttnb,LOC107698997,LOC107716993,LOC107657493,LOC107601612 coding downstream 1136158 20760046 ~ 20761027 (-)
LOC122351732 ttnb,LOC107657493,LOC107714355,LOC107601612,LOC107716993 coding downstream 1140072 20755896 ~ 20757113 (-)
neurod1 neurod1,LOC107601389,LOC107755376,LOC107676085,LOC107716998,LOC107601620 coding upstream 317845 22225558 ~ 22228499 (-)
LOC122352034 pde1a,LOC107716994,LOC107699023,LOC107676083,LOC106582264 coding upstream 433695 22341408 ~ 22398653 (-)
LOC122351832 NA coding upstream 574513 22482226 ~ 22484709 (-)
dusp19a dusp19a,dusp19,LOC107739447,LOC107699004,LOC107601374,LOC107601606,LOC107755360,LOC106586411 coding upstream 630262 22537975 ~ 22541710 (-)
dnajc10 dnajc10,LOC107755373,LOC107739439,LOC107699025,LOC107676092 coding upstream 690115 22597828 ~ 22610069 (-)
G72377 ttnb,LOC107716993,LOC107698997,LOC107714355,LOC107601612,LOC107657493 non-coding downstream 159663 21736441 ~ 21737522 (-)
G72372 NA non-coding downstream 164189 21732308 ~ 21732996 (-)
G72260 ttn.2,LOC107714399,LOC107657509,LOC107601611,LOC108435065 non-coding downstream 281501 21607794 ~ 21615684 (-)
G72026 NA non-coding downstream 460907 21433857 ~ 21436278 (-)
G72024 NA non-coding downstream 466844 21429128 ~ 21430341 (-)
G72479 NA non-coding upstream 34854 21942567 ~ 21942990 (-)
G72472 NA non-coding upstream 88222 21995935 ~ 22056835 (-)
G72493 NA non-coding upstream 192313 22100026 ~ 22100238 (-)
G72500 NA non-coding upstream 215477 22123190 ~ 22123408 (-)
G72502 ppp1r1c,LOC107699022,LOC107601387,LOC107716995,LOC107755374,LOC107676093 non-coding upstream 379061 22286774 ~ 22295068 (-)
G72363 ttnb,LOC107716993,LOC107698997,LOC107657493,LOC107601612,LOC107714355,LOC108435066 other downstream 170365 21709288 ~ 21726820 (-)
G71938 nab1,LOC107565022 other downstream 1393295 20489164 ~ 20503890 (-)
mfsd6b mfsd6,mfsd6b,LOC107660588,LOC107657524,LOC107714386,LOC107728923 other downstream 2003870 19881550 ~ 19893315 (-)
nab1b nab1b,LOC107602153,LOC107660590,LOC107565022,LOC107714351,LOC107657527,LOC107728906 other downstream 2044560 19833920 ~ 19852625 (-)
glsb glsb,gls,LOC107660591,LOC107728921,LOC107714384,LOC107657529,LOC107602138,LOC106531437 other downstream 2067710 19796252 ~ 19829475 (-)
cerkl cerkl,LOC107699018,LOC107716999,LOC107755377,LOC107601393,LOC107676088 other upstream 263750 22171463 ~ 22223667 (-)
LOC122351746 pde1a,LOC107716994,LOC107699023,LOC107676083,LOC107601607,LOC106582264,LOC107755361,LOC108443795 other upstream 389294 22297007 ~ 22511307 (-)
G72930 LOC107656510,LOC107564128,LOC107744821,LOC107688951,LOC107596585 other upstream 2022494 23930207 ~ 23931329 (-)
grb14 grb14,LOC107722903,LOC107558602,LOC107677902 other upstream 2036272 23943985 ~ 23960325 (-)
G72978 LOC107722896,LOC107674757,LOC107558607,LOC107677899,LOC107755197,LOC107600691 other upstream 2312809 24220522 ~ 24280708 (-)

Expression


Co-expression Network