LOC122351750 (igfbp2b,LOC107601376,LOC107719878,LOC107656525,LOC107739679,LOC107688948,LOC107567301)


Basic Information

Item Value
gene id LOC122351750
gene name igfbp2b,LOC107601376,LOC107719878,LOC107656525,LOC107739679,LOC107688948,LOC107567301
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 23914681 ~ 23918652 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043249022.1
ATGCCCAAATCCTTTAACCTACCCTTCCCTTCATCAGGAGAATTAAATGGCACGCGGTCCCCTCCAGTAAAAAAGCCTGGCAAAGAAAGCAACTACCAGCACATCAAGGAAATGGCCGTAAAGCAGCATCTCAGTAACAAGAGGACCAGGATGTACAGCCCCCAGGATGATCCCAAAACACCTCACCCCAGACAGAGCCAGTGTCAACAGGAGCTGGACAGAGTTTTGGAGAACATCTCCCGAATGACGTTCCATGACAACAAGGGACCTTTGGAAAATCTTTATGACCTGAAGTTCCCCAACTGTGACAAGACAGGACAGTACAACCTTAAACAGTGCAACATGTCCAGCCACGGACAGAGGGGCGAGTGTTGGTGCGTCAACCCCTACACTGGTGTCCAGATACCCTCGTCCCCCAAAGTGAGGGGGGACCCCAACTGCAGCCAGTACTACGGTGGTCCTGAGCTGGAACCGCCCACCAGCCAGCAGAAATAGACGTACCCTCGCCCTTAAGGGAGA

Function

symbol description
igfbp2b Enables insulin-like growth factor I binding activity. Involved in negative regulation of developmental growth. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in gut; kidney; liver; muscle; and ovary. Human ortholog(s) of this gene implicated in obesity. Orthologous to human IGFBP2 (insulin like growth factor binding protein 2).

NR:

description
PREDICTED: insulin-like growth factor-binding protein 2-B

GO:

id name namespace
GO:0043567 regulation of insulin-like growth factor receptor signaling pathway biological_process
GO:0008156 negative regulation of DNA replication biological_process
GO:0007275 multicellular organism development biological_process
GO:0001558 regulation of cell growth biological_process
GO:0008285 negative regulation of cell population proliferation biological_process
GO:0048640 negative regulation of developmental growth biological_process
GO:0005576 extracellular region cellular_component
GO:0031994 insulin-like growth factor I binding molecular_function
GO:0031995 insulin-like growth factor II binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043249022.1 True 519 mRNA 0.53 3 23914681 23918652

Neighbor

gene id symbol gene type direction distance location
LOC122351749 NA coding downstream 197626 23716109 ~ 23717055 (-)
LOC122352061 igfbp5b,LOC107656526,LOC107719877,LOC107601375,LOC107739616,LOC107567302 coding downstream 265121 23564379 ~ 23649560 (-)
gjc4b cx43.4,LOC107704825,LOC107741582,LOC107601378,LOC107688946,LOC107739588 coding downstream 488247 23419262 ~ 23426434 (-)
LOC122351748 LOC107601359,LOC107704822,LOC107741586,LOC107739717,LOC107688954,LOC107601360 coding downstream 503691 23390692 ~ 23410990 (-)
LOC122352042 LOC107704822,LOC107739717,LOC107688954,LOC107601359,LOC107741586,LOC107601360 coding downstream 624542 23281514 ~ 23290139 (-)
cobll1b cobll1,LOC107674769,LOC107755205 coding upstream 63318 23981970 ~ 24029114 (-)
slc38a11 slc38a11,LOC107674763,LOC107677901 coding upstream 110857 24029509 ~ 24038130 (-)
csrnp3 csrnp3,LOC107674773,LOC107722915,LOC107755203,LOC107677900 coding upstream 224014 24142666 ~ 24193802 (-)
stk39 stk39,LOC107707604,LOC107708317,LOC107558608 coding upstream 506874 24425526 ~ 24482087 (-)
spc25 spc25,LOC107707602,LOC107564152,LOC107677909,LOC107708316,LOC107674771,LOC107566753 coding upstream 611020 24529672 ~ 24533048 (-)
G72927 NA non-coding downstream 795 23912173 ~ 23913886 (-)
G72923 NA non-coding downstream 2645 23911453 ~ 23912036 (-)
G72918 NA non-coding downstream 280604 23558753 ~ 23634077 (-)
G72904 NA non-coding downstream 313789 23598987 ~ 23600892 (-)
G72909 NA non-coding downstream 374578 23537504 ~ 23540103 (-)
G72929 NA non-coding upstream 7571 23926223 ~ 23981238 (-)
G72980 NA non-coding upstream 334710 24253362 ~ 24285690 (-)
G72984 NA non-coding upstream 363339 24281991 ~ 24284165 (-)
G73077 NA non-coding upstream 594442 24513094 ~ 24521308 (-)
G73084 rdh1,LOC107566765,LOC107744825,LOC107674762,LOC106581784 non-coding upstream 646229 24564881 ~ 24571112 (-)
LOC122351746 pde1a,LOC107716994,LOC107699023,LOC107676083,LOC107601607,LOC106582264,LOC107755361,LOC108443795 other downstream 1403374 22297007 ~ 22511307 (-)
cerkl cerkl,LOC107699018,LOC107716999,LOC107755377,LOC107601393,LOC107676088 other downstream 1691014 22171463 ~ 22223667 (-)
G72363 ttnb,LOC107716993,LOC107698997,LOC107657493,LOC107601612,LOC107714355,LOC108435066 other downstream 2187861 21709288 ~ 21726820 (-)
G71938 nab1,LOC107565022 other downstream 3410791 20489164 ~ 20503890 (-)
mfsd6b mfsd6,mfsd6b,LOC107660588,LOC107657524,LOC107714386,LOC107728923 other downstream 4021366 19881550 ~ 19893315 (-)
G72930 LOC107656510,LOC107564128,LOC107744821,LOC107688951,LOC107596585 other upstream 11555 23930207 ~ 23931329 (-)
grb14 grb14,LOC107722903,LOC107558602,LOC107677902 other upstream 25333 23943985 ~ 23960325 (-)
G72978 LOC107722896,LOC107674757,LOC107558607,LOC107677899,LOC107755197,LOC107600691 other upstream 301870 24220522 ~ 24280708 (-)
G73201 NA other upstream 1108933 25027585 ~ 25030965 (-)
G73301 NA other upstream 1430126 25348778 ~ 25349640 (-)

Expression


Co-expression Network