LOC122351901 (si:dkey-57a22.15,LOC107668860,LOC107597434,LOC107724448,LOC107658273,LOC107568805,LOC107705156)


Basic Information

Item Value
gene id LOC122351901
gene name si:dkey-57a22.15,LOC107668860,LOC107597434,LOC107724448,LOC107658273,LOC107568805,LOC107705156
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 14196704 ~ 14197466 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043249302.1
ATGGGCAAGATTGTTTTTTACGAGGACAAGAATTTTCAAGGTCGTAGTTATGAGTGCAGTAACGACTGCACAGACCTGCACACTTACTTTAGTCGCTGCAACTCCATCAGAGTAGAGAGTGGCTGTTTCATGATATACGAACGTCCAAATTATATGGGCCATCAGTATTTTATGAAGCGAGGAGAGTATTCTGACTACCAGAGATGGATGGGCTTCAGTAGCTGTATTCGATCCTGTCGCCTGATTCCAATGGTGAGCTACAGGGGACCCTACAGACTGAGGATCTATGAGAAGGCTGACTACGGAGGGCACATGATGGAATTCGCAGACGACTGCCCCTGTGTGTCTGATCGTTTCCACCATCGACATGTGTACTCCTGTAACGTGATGAATGGCTACTGGATCTTCTATGAATATCCCAACTACAGAGGGAGGCAGTACTTCCTGAAATCTGGGGAATACAGGAGATACCGAGACTGGTGTGCTACCTGTGCCATTGTGGGCTCCTTCAGACGAGTCACTGATTATTAG
>XM_043249303.1
ATGGGCAAGATTGTTTTTTACGAGGACAAGAATTTTCAAGGTCGTAGTTATGAGTGCAGTAACGACTGCACAGACCTGCACACTTACTTTAGTCGCTGCAACTCCATCAGAGTAGAGAGTGGCTGTTTCATGATATACGAACGTCCAAATTATATGGGCCATCAGTATTTTATGAAGCGAGGAGAGTATTCTGACTACCAGAGATGGATGGGCTTCAGTAGCTGTATTCGATCCTGTCGCCTGATTCCAATGTACAGGGGACCCTACAGACTGAGGATCTATGAGAAGGCTGACTACGGAGGGCACATGATGGAATTCGCAGACGACTGCCCCTGTGTGTCTGATCGTTTCCACCATCGACATGTGTACTCCTGTAACGTGATGAATGGCTACTGGATCTTCTATGAATATCCCAACTACAGAGGGAGGCAGTACTTCCTGAAATCTGGGGAATACAGGAGATACCGAGACTGGTGTGCTACCTGTGCCATTGTGGGCTCCTTCAGACGAGTCACTGATTATTAG

Function

symbol description
si:dkey-57a22.15 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Human ortholog(s) of this gene implicated in cataract; cataract 2 multiple types; and cataract 39 multiple types. Orthologous to human CRYGB (crystallin gamma B) and CRYGC (crystallin gamma C).

NR:

description
PREDICTED: gamma-crystallin M2-like

GO: NA

KEGG:

id description
K23483 CRYG; gamma-crystallin

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043249302.1 True 531 mRNA 0.47 3 14196704 14197466
XM_043249303.1 False 525 mRNA 0.47 3 14196704 14197466

Neighbor

gene id symbol gene type direction distance location
crygm1 crygm1,zgc:153846,LOC107568769,LOC107668858,LOC107724461,LOC107705171 coding downstream 1212 14194683 ~ 14195492 (-)
LOC122351874 crygm1,zgc:153846,LOC107568769,LOC107668858,LOC107724461,LOC107705171 coding downstream 6080 14189604 ~ 14190624 (-)
LOC122352116 LOC107568713,LOC107555340,LOC107555339,LOC107555341,LOC107664838,LOC107705172 coding downstream 24186 14171789 ~ 14172518 (-)
crygs4 crygs4,LOC107723662,LOC107555042,LOC107669732,LOC107658282,LOC107705158 coding downstream 99090 14096875 ~ 14097614 (-)
crygs3 crygs3,LOC107555333,LOC107658281,LOC107705159,LOC107723661,LOC107686303 coding downstream 102812 14092927 ~ 14093892 (-)
crygm6 crygm6,LOC107724479,LOC107568790,LOC107668857,LOC107658269,LOC107705155 coding upstream 1760 14199226 ~ 14200065 (-)
si:dkey-57a22.14 LOC107724481,LOC107668873,LOC107597431,LOC107658270,LOC107705154,LOC107568754 coding upstream 3402 14200868 ~ 14201664 (-)
crygm7 crygm7,LOC107705168,LOC107597399,LOC107724483,LOC107568737,LOC107658272,LOC105899368 coding upstream 5319 14202785 ~ 14203488 (-)
LOC122351222 LOC107724482,LOC107668894,LOC107568746,LOC107658271,LOC107705167,LOC107597398,LOC103037082 coding upstream 6866 14204332 ~ 14208306 (-)
LOC122351400 LOC107568797,LOC107724467,LOC107682866 coding upstream 8301 14205767 ~ 14207351 (-)
LOC122352120 NA non-coding downstream 7703 14173817 ~ 14189001 (-)
G70309 NA non-coding downstream 271868 13924616 ~ 13924836 (-)
G70308 NA non-coding downstream 272600 13923749 ~ 13924104 (-)
G70306 NA non-coding downstream 318292 13878124 ~ 13878412 (-)
G70305 LOC107725229,LOC107658288 non-coding downstream 320238 13873518 ~ 13876466 (-)
G70332 LOC107724468 non-coding upstream 46821 14244287 ~ 14247328 (-)
G70382 NA non-coding upstream 279866 14477332 ~ 14562992 (-)
G70393 NA non-coding upstream 392392 14589858 ~ 14590275 (-)
G70396 NA non-coding upstream 396797 14594263 ~ 14595342 (-)
G70438 LOC107600383,LOC107655530,LOC107720111 non-coding upstream 719334 14916800 ~ 14918840 (-)
G70294 NA other downstream 256836 13938259 ~ 13939868 (-)
rif1 LOC107658288,LOC107555351,LOC107658286,LOC107725242,LOC107680950 other downstream 283761 13879570 ~ 13912943 (-)
G70261 LOC107682829,LOC107723691,LOC107555352,LOC107658202,LOC107555050 other downstream 383377 13807822 ~ 13813327 (-)
tmem163a tmem163a,LOC107658221,LOC107725256,LOC107684456,LOC107555363,LOC106586306,LOC106582396 other downstream 522897 13642303 ~ 13673807 (-)
gypc gypc,LOC107723681,LOC107725252,LOC107555063,LOC107567781,LOC107684853,LOC107695565 other downstream 701037 13473135 ~ 13495667 (-)
LOC122351495 NA other upstream 162180 14359646 ~ 14372674 (-)
G70549 NA other upstream 1105637 15303103 ~ 15305975 (-)
tmtc4 tmtc4,LOC107748611,LOC107569561,LOC107681320,LOC107600375,LOC107694590 other upstream 1191752 15389218 ~ 15399437 (-)
G70663 plcl1,LOC107731752,LOC107569711,LOC107690606,LOC107659890,LOC107595846,LOC107719808 other upstream 1573955 15771421 ~ 15771864 (-)
dcaf6 LOC107673675,LOC107695452,LOC107748145,LOC107595867 other upstream 2523338 16720804 ~ 16746222 (-)

Expression


Co-expression Network