crygmxl1 (crygmxl1,LOC107705174,LOC107597436,LOC107668863,LOC108424292,LOC103034814)


Basic Information

Item Value
gene id crygmxl1
gene name crygmxl1,LOC107705174,LOC107597436,LOC107668863,LOC108424292,LOC103034814
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 14182515 ~ 14183289 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043249652.1
ATGGGAAAGATCATCTTCTATGAAGACAAGAACTTTCAGGGCCACTCCTATGAGTGCAGTGGCGACTGTACTGACCTGCACTCTCATTTCAGTCGCTGTAACTCCATCCGGGTTGAAAGTGGGAACTGGATGGTATATGAGAGACCACACTTTATGGGTTACCAGTACTTTCTGCACAAACGTGAATACGCTAACTACCAACTGTGGATGGGTTTCAACGATTGTGTCAGATCCTGTCGAATGATACCCCAACACCAGGGATCCTACAAAATGATGATCTATGAACGTCCAGACTTTGGTGGTCAGATGATGGAGTTCACTGATGACTGTCCATTACTTCATGATCAATTCCATTACAATGATATCCATTCTTGCAATGTTCAAGAAGGATACTGGATCTTCTACGAGCATACTAATTACAGAGGCAGACAATACCTCCTCAGACCTGGTGAATACAGGAGGTACAGTGACTGGGGTGCCATGAGCTCAAGAGTTAGTTCTATCAGACGTATTACCTTGGGAAACTGA

Function

symbol description
crygmxl1 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in lens. Human ortholog(s) of this gene implicated in cataract; cataract 2 multiple types; cataract 39 multiple types; cataract 4 multiple types; and cataract 7. Orthologous to several human genes including CRYGB (crystallin gamma B).

NR:

description
PREDICTED: gamma-crystallin M2-like

GO: NA

KEGG:

id description
K23483 CRYG; gamma-crystallin

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043249652.1 True 528 mRNA 0.44 3 14182515 14183289

Neighbor

gene id symbol gene type direction distance location
LOC122352118 LOC107568713,LOC107724462,LOC107663981,LOC107705172,LOC107664838 coding upstream 3340 14178373 ~ 14179175 (+)
LOC122352119 crygm2a,LOC107568720,LOC107724460,LOC107663175,LOC107705169,LOC107597400,LOC107724459,LOC107658274 coding upstream 8135 14173495 ~ 14174380 (+)
LOC122351862 LOC107664838,LOC107555340,LOC107568713,LOC107555341 coding upstream 11939 14169680 ~ 14170576 (+)
LOC122351493 LOC107724463,LOC107555344,LOC107664838,LOC107555340 coding upstream 14948 14166746 ~ 14167567 (+)
LOC122351492 LOC107597405,LOC107705173,LOC107724463 coding upstream 26011 14155724 ~ 14156504 (+)
uchl3 uchl3,LOC107668893,LOC107658267 coding downstream 29936 14213225 ~ 14217247 (+)
lmo7a lmo7,lmo7a,LOC107724468,LOC107668875,LOC107705164,LOC107658265,LOC107597393 coding downstream 34874 14218163 ~ 14259089 (+)
acod1 LOC107705150,LOC107597428,LOC107658213,LOC107724458,LOC107568925,LOC107668871 coding downstream 96896 14280185 ~ 14283564 (+)
mrpl30 mrpl30,LOC107724503,LOC107668904,LOC107568953,LOC107705162,LOC107658263 coding downstream 102659 14285948 ~ 14287061 (+)
aff3 LOC107569057,LOC107668839,LOC107658210,LOC107597387,LOC107724445,LOC107712257 coding downstream 247474 14430763 ~ 14447802 (+)
G70064 NA non-coding upstream 242785 13931619 ~ 13939730 (+)
G70045 si:dkey-91i10.3,LOC107658292,LOC107725254,LOC107555015,LOC107683415,LOC107723676,LOC107555356 non-coding upstream 395394 13777632 ~ 13787121 (+)
G70043 NA non-coding upstream 413086 13769229 ~ 13769429 (+)
G70032 NA non-coding upstream 490028 13692214 ~ 13692487 (+)
LOC122351436 LOC107555330 non-coding upstream 493482 13686665 ~ 13689033 (+)
LOC122352011 NA non-coding downstream 123258 14306547 ~ 14329484 (+)
G70125 NA non-coding downstream 149011 14332300 ~ 14335751 (+)
G70181 NA non-coding downstream 395981 14579270 ~ 14580468 (+)
G70184 NA non-coding downstream 400942 14584231 ~ 14584488 (+)
G70185 NA non-coding downstream 401302 14584591 ~ 14585026 (+)
ccnt2a ccnt2a,LOC107658298,LOC107725237,LOC107723659,LOC107684218,LOC107555058,LOC107555362 other upstream 497680 13676163 ~ 13684835 (+)
G69834 col6a3,LOC107685998,LOC107567775,LOC107670696 other upstream 877924 13289693 ~ 13304591 (+)
G69755 NA other upstream 1196537 12984868 ~ 12985978 (+)
LOC122351618 clasp1a,clasp2,LOC107741904,LOC107714287,LOC107673735,LOC107596084,LOC107706129,LOC107696541,LOC107669402 other upstream 1379107 12732298 ~ 12803408 (+)
G69670 LOC107673130,LOC107555834,LOC107709428,LOC107724029,LOC107675357 other upstream 1552980 12627535 ~ 12629535 (+)
LOC122351767 NA other downstream 403793 14587082 ~ 14589439 (+)
si:ch211-168k14.2 si:ch211-168k14.2,LOC107681321,LOC107748618,LOC108441415,LOC105905900,LOC108266656,LOC107600399 other downstream 1217838 15401127 ~ 15425361 (+)
LOC122351678 hspe1,mob4,LOC107690609,LOC107595852,LOC107569672,LOC107731766,LOC106586370,LOC105016277,LOC100701317,LOC103156730,LOC101472107,LOC102310674,LOC102783361,LOC108238849,LOC107690608,LOC106582314,LOC105899369 other downstream 1524912 15708201 ~ 15715901 (+)
plcl1 LOC107569711,LOC107731752,LOC107690606,LOC107719808,LOC107659890,LOC107595846 other downstream 1551281 15734570 ~ 15789702 (+)
rabl3 rabl3,LOC107569739,LOC107690631,LOC107659889,LOC107595844,LOC107736356 other downstream 1716138 15899427 ~ 15901720 (+)

Expression


Co-expression Network