LOC122351161


Basic Information

Item Value
gene id LOC122351161
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 3642961 ~ 3646614 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XR_006251706.1
CCCGTTGCGGGGGCCCGCTCGGATTGTCGGAGCCGCTACCAGCTTCTTCTCTCAGGGCGAGCACTGGCGGAGCGCTACCGGAGGATTTACACCACCGCGATCAACGACAAAGAGCAGGGGCTCAACCTCGGCAGGGGAAAGAAAGCTTTGAGCAAGAAGAAGCT

Function

GO:

id name namespace
GO:0042068 regulation of pteridine metabolic process biological_process
GO:0031290 retinal ganglion cell axon guidance biological_process
GO:0016198 axon choice point recognition biological_process
GO:0016567 protein ubiquitination biological_process
GO:0021986 habenula development biological_process
GO:0005737 cytoplasm cellular_component
GO:0005515 protein binding molecular_function
GO:0004842 ubiquitin-protein transferase activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_006251706.1 True 164 lncRNA 0.61 2 3642961 3646614

Neighbor

gene id symbol gene type direction distance location
vwa8 vwa8 coding upstream 58270 3507925 ~ 3584691 (+)
epsti1 epsti1,LOC107549908 coding upstream 258784 3363734 ~ 3384177 (+)
enox1 enox1,LOC107661308,LOC107713727,LOC107561323,LOC107688647 coding upstream 505016 3054362 ~ 3137945 (+)
tsc22d1 tsc22d1,LOC107551985,LOC107748883,LOC107713726,LOC107576221,LOC107561310,LOC107688650 coding upstream 626452 2978307 ~ 3016509 (+)
kctd4 kctd4,LOC107748885,LOC107688678,LOC107713709,LOC107580010 coding upstream 674996 2966046 ~ 2967965 (+)
mycbp2 mycbp2,LOC107549765,LOC107664005 coding downstream 23948 3670562 ~ 3742739 (+)
fbxl3a fbxl3,fbxl3a,LOC107549764,LOC107664003,LOC107670904 coding downstream 97392 3744006 ~ 3752623 (+)
rsph1 rsph1,LOC107749034,LOC107728239,LOC107670901,LOC107663994 coding downstream 108202 3754816 ~ 3759215 (+)
stx19 stx19,LOC107664001,LOC107749033,LOC107728237 coding downstream 114219 3760833 ~ 3767537 (+)
LOC122351330 LOC107571834,LOC107657380,LOC107716910 coding downstream 260127 3906741 ~ 3910820 (+)
G67418 NA non-coding upstream 4879 3601318 ~ 3638082 (+)
LOC122351601 LOC107749038,LOC107663997 non-coding upstream 23655 3606570 ~ 3619306 (+)
LOC122351351 NA non-coding upstream 50721 3586803 ~ 3592240 (+)
G67396 NA non-coding upstream 201217 3437097 ~ 3441744 (+)
G67389 NA non-coding upstream 218540 3419087 ~ 3424421 (+)
G67448 NA non-coding downstream 182209 3828823 ~ 3829772 (+)
G67562 LOC107588232,LOC107742953,LOC107671312,LOC107657349 non-coding downstream 299920 3946534 ~ 4031820 (+)
G67604 NA non-coding downstream 391982 4038596 ~ 4038822 (+)
G67606 NA non-coding downstream 418023 4064637 ~ 4064961 (+)
G67637 NA non-coding downstream 510042 4156656 ~ 4157963 (+)
LOC122351398 dnajc15,LOC107549910 other upstream 362909 3262607 ~ 3280052 (+)
LOC122351419 polr2e,polr2eb,LOC107592678,LOC107669821,LOC107599482 other upstream 446343 3194773 ~ 3196618 (+)
bpifcl bpi other upstream 1906641 1713812 ~ 1736320 (+)
G66795 NA other upstream 2507972 1127526 ~ 1134989 (+)
LOC122351650 si:ch1073-55a19.2,LOC107670647,LOC107709149,LOC107686982,LOC107559216,LOC108440489,LOC107686979,LOC107709150 other upstream 2743582 858680 ~ 899379 (+)
LOC122352174 rbm45,LOC107716918,LOC107752596 other downstream 267024 3913638 ~ 3922878 (+)
G67566 LOC107742952,LOC107718452,LOC107671286,LOC107715667 other downstream 301422 3948036 ~ 3983582 (+)
cdca7a LOC107718452,LOC107671286,LOC107588247,LOC107742973,LOC107657370,LOC107600694 other downstream 334732 3981346 ~ 3985962 (+)
scrn3 scrn3,LOC107739455,LOC107671317,LOC107588231,LOC107657366,LOC107600698 other downstream 473913 4120527 ~ 4127013 (+)
G67630 NA other downstream 494440 4141054 ~ 4222171 (+)

Expression


Co-expression Network