G6636


Basic Information

Item Value
gene id G6636
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 25838851 ~ 25846530 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU9691
GGAACGTTTGATCTGAAGCGTGATGAGGGAGCACACGTAACACGAGCTCAACGGACCTTCACCTCTCTGATGAAGTCCGACCAGTCCTTGTTCTGAATGATCCTAACCAGGCCTTGACTGATCCGGAAGGTGGCGTCCTCGTCGAAGCGGCCCTGACCTAAATGATGCGTCACGTAAACCCTGTCAAACCACGTGTCGCACCAGTCTGAATCGACCAAACAACGACGCGGGTCTGCGCTTGCTCTCACGTACATCAGGGTTGTAATTCTTGGTAACATTATTAGGCATCGCTCCGGGTCGGTGCAGGTTACCGATTTCATAATACTGCAGGTCAGTATCAGGAAGAATTCCTTCTGAGTTATGGAACGGATGGAAACCAAAATCTCGGTGTTCTGGGTCGCACAGTGCGATCATATTG

Function

GO:

id name namespace
GO:0002253 activation of immune response biological_process
GO:0006955 immune response biological_process
GO:0048584 positive regulation of response to stimulus biological_process
GO:0002376 immune system process biological_process
GO:0002682 regulation of immune system process biological_process
GO:0002684 positive regulation of immune system process biological_process
GO:0050776 regulation of immune response biological_process
GO:0050778 positive regulation of immune response biological_process
GO:0002218 activation of innate immune response biological_process
GO:0002221 pattern recognition receptor signaling pathway biological_process
GO:0002224 toll-like receptor signaling pathway biological_process
GO:0002757 immune response-activating signal transduction biological_process
GO:0002758 innate immune response-activating signal transduction biological_process
GO:0002764 immune response-regulating signaling pathway biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05144 Malaria

RNA

RNA id representative length rna type GC content exon number start site end site
TU9691 True 418 lncRNA 0.51 2 25838851 25846530

Neighbor

gene id symbol gene type direction distance location
aptx aptx,LOC107757069,LOC107746089 coding downstream 25002 25809879 ~ 25813849 (-)
LOC122353214 vps54,LOC107700845,LOC107598476,LOC107709616 coding downstream 111313 25716158 ~ 25727538 (-)
LOC122353232 rnf150a,LOC107694428,LOC107653218,LOC107564413,LOC107725723,LOC107729769,LOC107700883 coding downstream 124877 25706824 ~ 25713974 (-)
LOC122349099 LOC107700791,LOC107729560,LOC107598497,LOC107729568,LOC107706374,LOC107595808,LOC107687795 coding downstream 137567 25687797 ~ 25701284 (-)
junba junba,LOC107594404,LOC107757044,LOC107747424,LOC107684248,LOC107675464 coding downstream 260052 25577222 ~ 25578799 (-)
il15 LOC107730128 coding upstream 222646 26069176 ~ 26076862 (-)
znf330 znf330,LOC107746098 coding upstream 230735 26077265 ~ 26083184 (-)
elmod2 elmod2 coding upstream 289176 26135706 ~ 26141269 (-)
zgc:66455 NA coding upstream 295254 26141784 ~ 26147822 (-)
b3gnt2a LOC107703838,LOC107746084,LOC107729991,LOC107576349,LOC107598544 coding upstream 301402 26147932 ~ 26155748 (-)
G6594 NA non-coding downstream 39578 25768907 ~ 25799273 (-)
G6223 NA non-coding downstream 101539 25736797 ~ 25737312 (-)
G6201 NA non-coding downstream 217106 25621434 ~ 25621745 (-)
G6200 NA non-coding downstream 218347 25620246 ~ 25620504 (-)
G6165 NA non-coding downstream 333997 25503940 ~ 25504854 (-)
G6650 NA non-coding upstream 72040 25918570 ~ 25918785 (-)
G6652 NA non-coding upstream 91891 25938421 ~ 25938851 (-)
G6687 NA non-coding upstream 218029 26064559 ~ 26066186 (-)
G6670 NA non-coding upstream 245479 26092009 ~ 26096257 (-)
G6596 NA non-coding upstream 342528 26189058 ~ 26190510 (-)
LOC122353196 zgc:136864,c26h19orf53,LOC107598479,LOC107700848,LOC107747197,LOC105901798,LOC106531096 other downstream 123147 25714102 ~ 25715704 (-)
prokr1a prokr1a,LOC107594458,LOC107676304,LOC107747445,LOC107757000,LOC108441199 other downstream 281869 25547725 ~ 25556982 (-)
G6135 ndufaf5,LOC107675590,LOC107594415 other downstream 436496 25400384 ~ 25402355 (-)
G6134 ndufaf5,LOC107594462,LOC107594415,LOC107583196,LOC107684300 other downstream 438834 25398491 ~ 25400017 (-)
G6124 actr2,LOC108423375 other downstream 530880 25304597 ~ 25307971 (-)
G6592 ucp1,LOC107730009,LOC107598545,LOC107703842,LOC107700810 other upstream 284258 26130788 ~ 26135486 (-)
smdt1b LOC107598503,LOC107700869,LOC107594281,LOC107746113,LOC107703822 other upstream 570329 26416859 ~ 26417897 (-)
LOC122353745 slc9a3r2,LOC107729606 other upstream 607720 26454250 ~ 26523402 (-)
c1h19orf53 zgc:136864,c26h19orf53,LOC107598479,LOC107700848,LOC107747197,LOC105901798,LOC106531096 other upstream 955380 26801910 ~ 26802954 (-)
si:ch211-286b5.5 NA other upstream 1071139 26917669 ~ 26920034 (-)

Expression


Co-expression Network