LOC122350619 (dctpp1,LOC107695562)


Basic Information

Item Value
gene id LOC122350619
gene name dctpp1,LOC107695562
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 13842778 ~ 13843391 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043247273.1
GTTCATAAACCGCGTATCGATATCTGTGGGGCAGCTGGTGGCGGGAGATTCGCGCATGGTCCTGCACGTCAACGATCATCTTTGAGCGCTTCTCTACTTTCAGGATTTGCCTTTCGCTCTTTAAATTACAATGGCGCTGCAGCAAAACGGGATCGGATCCAAACACAGCGGTGACACTTCCAGCGATCGCCCATCTACGAACGGGAGCGGAGAAGTCCAGCGTGACCGGGCTGGGTTCACGTTCACCTCCGAGCCCACTCTTGAGGACATCCGCCGCATGCAGACTGAATTCACGGAAGAGAGGAACTGGAACCAGTTCCACAAGCCGCGGAACCTGCTGCTGGCGCTGGTCGGGGAGGTCGGGGAGGTGGCGGAGCTCTTCCAGTGGCGCGGGGAGGTGGAGGAGGGTCTGCCGGACTGGACCGAGCCGCAGCGGGAGCACCTGGCCCAGGAGCTCAGCGACGTGTTGATCTATCTGGTCGAACTGGCAGAGAAATGCCACGTTGATCTGCCTCAAGCTGTCCTCCGCAAAATGGCCCTTAACCGACTCAAGTACCCGGCCAGCAAAGTTCACGGGTCTGCCAAGAAGTACACCGAGTACAAGGACTGATG

Function

symbol description
dctpp1 Predicted to enable dCTP diphosphatase activity. Predicted to be involved in DNA protection and dCTP catabolic process. Predicted to act upstream of or within nucleoside triphosphate catabolic process. Predicted to be located in cytoplasm. Predicted to be active in cytosol. Is expressed in several structures, including immature eye; midbrain; neural plate; neural tube; and spinal cord. Human ortholog(s) of this gene implicated in combined oxidative phosphorylation deficiency 41. Orthologous to several human genes including DCTPP1 (dCTP pyrophosphatase 1).

NR:

description
PREDICTED: dCTP pyrophosphatase 1-like

GO: NA

KEGG:

id description
K16904 DCTPP1; dCTP diphosphatase

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043247273.1 True 612 mRNA 0.58 2 13842778 13843391

Neighbor

gene id symbol gene type direction distance location
fhip1aa fam160a1,fam160a1a,LOC107745858,LOC107695572,LOC107700307,LOC107757618,LOC107598295 coding upstream 15396 13809693 ~ 13827382 (+)
rps3a rps3a,LOC107695588 coding upstream 56165 13783815 ~ 13786613 (+)
mab21l2 mab21l2,LOC107700304 coding upstream 183668 13656854 ~ 13659110 (+)
ncapg ncapg,LOC107700299,LOC107757563 coding upstream 408558 13423032 ~ 13434220 (+)
haspin LOC107695683,LOC108416162,LOC107722281,LOC107580791 coding upstream 444052 13390102 ~ 13398726 (+)
mnd1 mnd1,LOC107700309 coding downstream 569636 14413027 ~ 14424145 (+)
tmem131l LOC107695518,LOC107745862,LOC107757619,LOC107700308 coding downstream 581863 14425254 ~ 14459018 (+)
LOC122346953 pcdh8 coding downstream 647393 14490784 ~ 14498314 (+)
plrg1 plrg1,LOC107757621,LOC107695461,LOC107700313 coding downstream 740259 14583650 ~ 14588764 (+)
si:dkey-30k22.5 LOC107695853,LOC107572196 coding downstream 762061 14605452 ~ 14607397 (+)
LOC122345860 sh3d19,LOC107745872,LOC107695906,LOC107598296,LOC107700261 non-coding upstream 49938 13787434 ~ 13792840 (+)
G3125 NA non-coding upstream 244664 13597901 ~ 13598114 (+)
LOC122351052 NA non-coding upstream 458558 13380568 ~ 13384220 (+)
LOC122351590 NA non-coding upstream 469543 13370178 ~ 13373235 (+)
LOC122335725 NA non-coding upstream 474749 13364102 ~ 13368029 (+)
G3245 fbxw7,LOC107757568,LOC107745860 non-coding downstream 425521 14268912 ~ 14273785 (+)
G3262 NA non-coding downstream 559015 14402406 ~ 14406003 (+)
G3282 NA non-coding downstream 638039 14481430 ~ 14481806 (+)
G3322 arfip1,LOC107695488,LOC107745866,LOC107700312 non-coding downstream 683226 14526617 ~ 14528471 (+)
G3324 NA non-coding downstream 687625 14531016 ~ 14532206 (+)
slit2 slit2,LOC107700301,LOC107695646 other upstream 256797 13516208 ~ 13585981 (+)
rhoh rhoh,LOC107548321,LOC107598269,LOC107757583 other upstream 637062 13203059 ~ 13205716 (+)
dnah6 dnah6,LOC106610484 other upstream 1118320 12659262 ~ 12724458 (+)
kdm4c kdm4c,LOC107702398,LOC107548355,LOC107570226,LOC107655842,LOC107750465,LOC107709452 other upstream 1184271 12644679 ~ 12658507 (+)
LOC122350793 zbtb5,LOC107656143,LOC107702373,LOC107591545 other upstream 1998718 11837606 ~ 11844060 (+)
G3187 gatb,LOC107695556,LOC107695902 other downstream 271040 14114431 ~ 14118433 (+)
LOC122345399 NA other downstream 636807 14480198 ~ 14481346 (+)
lrata lrat,lrata,LOC107572197,LOC107714634,LOC107695864,LOC107700276,LOC107757590 other downstream 758921 14602312 ~ 14603888 (+)
npy2r npy2r,LOC107572195,LOC107714623,LOC107695741,LOC107757570,LOC107700264 other downstream 766853 14610244 ~ 14612677 (+)
G3380 LOC107572695,LOC107695836 other downstream 880154 14723545 ~ 14791788 (+)

Expression


Co-expression Network