G73559 (apbb1,LOC107750985,LOC107673752,LOC107565841)


Basic Information

Item Value
gene id G73559
gene name apbb1,LOC107750985,LOC107673752,LOC107565841
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056708.1
NCBI id CM032077.1
chromosome length 16503406
location 424953 ~ 427515 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU108834
CTTTGAGCAGATGTCATGCAGGCTGGTGGCGATGTTCTTTGCCGGGGTGTCACACCGAAACACGTGACACTTGAGCACGTGAGTCAACTTGTCTCGGGCCACATATGCAAAGTCCCTGTACCTGCCATCATCCCGTCCGACTCCCCACACGCGGATGCTGATGATGGGCTGAGAGTGCAGCAGCGTTCCCCCGTGAGGCTCGATCAGGTTCAGAGTCTCATTCTCCAGCACCAGAAGCATCTCCTTCCC

Function

symbol description
apbb1 Predicted to enable amyloid-beta binding activity. Predicted to be involved in regulation of transcription, DNA-templated. Predicted to be active in cytoplasm and nucleus. Human ortholog(s) of this gene implicated in Alzheimer's disease. Orthologous to human APBB1 (amyloid beta precursor protein binding family B member 1).

NR:

description
PREDICTED: amyloid beta A4 precursor protein-binding family B member 1 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU108834 True 249 lncRNA 0.57 2 424953 427515

Neighbor

gene id symbol gene type direction distance location
aldh7a1 aldh7a1 coding upstream 4499 412893 ~ 420454 (+)
LOC122353112 LOC107726979,LOC107669787,LOC568883,LOC107568003 coding upstream 187647 227167 ~ 237306 (+)
LOC122353215 NA coding upstream 330749 93311 ~ 94204 (+)
sub1a sub1,LOC107686443,LOC107562553,LOC107685153,LOC107713349,LOC107571107,LOC107552599 coding downstream 76845 504360 ~ 506120 (+)
pstpip2 pstpip2,LOC107744171,LOC107685173 coding downstream 80089 507604 ~ 515636 (+)
mtrex skiv2l2,LOC107744101,LOC107571110,LOC107713350,LOC107686493 coding downstream 108893 536408 ~ 564154 (+)
hvcn1 LOC107686438,LOC107744097,LOC107562590,LOC107685148,LOC107575472 coding downstream 186359 613874 ~ 616743 (+)
pptc7b pptc7b,LOC107744096,LOC107713343,LOC107685147,LOC106563180,LOC105909313 coding downstream 195757 623272 ~ 633992 (+)
G73519 NA non-coding upstream 27852 349033 ~ 397101 (+)
G73523 NA non-coding upstream 77046 347548 ~ 347907 (+)
G73465 NA non-coding upstream 132686 287869 ~ 292267 (+)
G73463 NA non-coding upstream 173872 206021 ~ 251081 (+)
G73467 LOC107580357 non-coding upstream 205329 208899 ~ 219624 (+)
G73560 NA non-coding downstream 1341 428856 ~ 429270 (+)
G73589 NA non-coding downstream 225029 652544 ~ 653003 (+)
G73588 NA non-coding downstream 226099 653614 ~ 673309 (+)
G73656 NA non-coding downstream 367820 795335 ~ 795689 (+)
G73710 NA non-coding downstream 377855 805370 ~ 805665 (+)
c10h5orf63 LOC107715565,LOC107657471,LOC107576909 other upstream 26094 396440 ~ 398859 (+)
LOC122352377 fbn2,LOC107705843,LOC107575594,LOC107565844,LOC562634 other upstream 138713 242243 ~ 286240 (+)
pmaip1 NA other downstream 255591 683106 ~ 774374 (+)
isl1b NA other downstream 264609 692124 ~ 695923 (+)
fstb fstb,LOC107685190,LOC107713293,LOC107686430,LOC107744087,LOC107597631,LOC107595577 other downstream 368496 796011 ~ 801923 (+)
rbm18 rbm18,LOC107597621,LOC107595545,LOC107685132,LOC107686423 other downstream 506554 934069 ~ 945860 (+)
LOC122352734 LOC107744074,LOC107597614,LOC107686419,LOC107685127,LOC101884949,LOC107713324,LOC107595548 other downstream 650181 1077696 ~ 1084039 (+)

Expression


Co-expression Network