CI01000000_11603826_11605350 (SLC25A43)


Basic Information

Item Value
gene id CI01000000_11603826_11605350
gene name SLC25A43
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 11603800 ~ 11605350 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000000_11603826_11605350.mRNA
AACTTCATCAATGGCTGTCTTGCGGCAGGAGTCGCTCAGACTCTCTCCTTCCCCTTTGAAACTGTTAAAAAGAAGATGCAGGCCCAGAGTCTTCTTTTGCCCCATTGTGGAGGAGCTGATGTCCATTTTAATGGAATGATAGACTGCTTCAGACAGGTCATTAAGAACAAGGGTGTCATGGCTCTTTGGAGTGGCCTTACAGCAAACACGGTGAAGATTGTCCCATATTTTGGTCTGCTCTTCAGTTGCTTTGAGATGTGTAAGCAAGTTTGCCTTTACCGGAATGGCTATATAATTTCTCCACTAAGCTACAAACTTACACCTGGTGTGGACCAAAGCCTAGGCCCATATGAACTAGAGGAGTTTAAGCGCTACCTGAGAAACAGAAAATCACACAAAGCACAGAGTTCATCCATAGGAAACCGCTGGTAACTATTCCAGGAGTTATCAGGAATAAA

Function

symbol description
slc25a43 Predicted to act upstream of or within transmembrane transport. Predicted to be located in mitochondrial inner membrane. Predicted to be integral component of membrane. Orthologous to human SLC25A43 (solute carrier family 25 member 43).

GO:

id name namespace
GO:0006810 transport biological_process

KEGG:

id description
K15120 SLC25A43; solute carrier family 25, member 43

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000000_11603826_11605350.mRNA True 458 mRNA 0.44 3 11603800 11605350

Neighbor

gene id symbol gene type direction distance location
CI01000000_11600258_11602519 SLC25A5.L, SLC25A6, SLC25A5, ANTS6 coding downstream 1220 11599982 ~ 11602580 (-)
CI01000000_11587766_11588330 NA coding downstream 15470 11587316 ~ 11588330 (-)
CI01000000_11584045_11586744 UBE2A, UBE2B, UBE2AL coding downstream 16818 11583971 ~ 11586982 (-)
CI01000000_11541564_11559682 INPPL1B coding downstream 44118 11541451 ~ 11559682 (-)
CI01000000_11536835_11537863 P2RY4 coding downstream 65092 11536313 ~ 11538708 (-)
CI01000000_11644676_11648034 CHIC1 coding upstream 38696 11644046 ~ 11648034 (-)
CI01000000_11650257_11652811 CDX1, CDX4 coding upstream 44554 11649904 ~ 11654726 (-)
CI01000000_11661528_11696310 NA coding upstream 55663 11661013 ~ 11696310 (-)
CI01000000_11721762_11759751 DLG3 coding upstream 116217 11721567 ~ 11759751 (-)
CI01000000_11788953_11800880 NA coding upstream 183553 11788903 ~ 11801346 (-)
G8180 NA non-coding downstream 410625 11192967 ~ 11193175 (-)
G8172 NA non-coding downstream 427776 11175754 ~ 11176024 (-)
G8161 NA non-coding downstream 458827 11144751 ~ 11144973 (-)
G8155 NA non-coding downstream 469103 11134400 ~ 11134697 (-)
G8142 NA non-coding downstream 504247 11099192 ~ 11099553 (-)
G8251 NA non-coding upstream 9376 11614726 ~ 11614965 (-)
G8246 NA non-coding upstream 13504 11618854 ~ 11619745 (-)
G8253 NA non-coding upstream 14751 11620101 ~ 11620367 (-)
G8254 NA non-coding upstream 15209 11620559 ~ 11620817 (-)
G8255 NA non-coding upstream 15832 11621182 ~ 11621419 (-)
G8125 NA other downstream 562891 11040269 ~ 11040909 (-)
CI01000000_10824957_10825464 MMGT1, TMM32 other downstream 776205 10824324 ~ 10825464 (-)
CI01000000_10407402_10409508 UBL3B, UBL3.S, UBL3 other downstream 1189287 10407395 ~ 10409950 (-)
G3931 NA other downstream 5200275 6157013 ~ 6403525 (-)
G3716 NA other downstream 5603031 6000407 ~ 6000769 (-)
G8699 NA other upstream 1679974 13272585 ~ 13311429 (-)
G9036 NA other upstream 2121450 13726800 ~ 13727090 (-)
G9602 NA other upstream 2735652 14341002 ~ 14346534 (-)
CI01000000_14200000_14436182 TENM2 other upstream 2780007 14200000 ~ 14436253 (-)
G10672 NA other upstream 4620937 16226287 ~ 16231126 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_007978 slc25a43 coding NC_007125.7 CM002898.2 32884731 ~ 32893785 (-)