LOC122352659 (mocs2,LOC107713337,LOC107744090)


Basic Information

Item Value
gene id LOC122352659
gene name mocs2,LOC107713337,LOC107744090
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056708.1
NCBI id CM032077.1
chromosome length 16503406
location 792323 ~ 793795 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043250178.1
TAAACAGAGCGTCACGTGTCTGTGCCCCGTCACGAGTCAGCTGACCTGAAGCGGAACCAATCAGATCGGGGCTTTGAGGAAGACGAGCCGACGCACGCGGCGAGGGGCTGAAGTTTAGTTGTCGTTCAGTCGATATACACACATGAATACCGAGGTGTCGGTTCTGTACTTTGCAAGAAGTGCCGAAATCACGGGACTTAAAGCAGAAAGCATCTCCGTGCCGTCAAACATCTCCTCTCTCCAGCTGTGGCAGGATCTGGAGACGAGACATCCGAGACTCTCTGTGTTACGGGATCAGGTGGTTCTGGCCGTGCGTCAGGAGTACGTGTCTCTGGGAGAGCAGCCCTTGACGCTCAGAGACGGGGACGAGGTGGCCGTTATACCGCCCCTCAGTGGAGGATAGACACAGCACC

Function

symbol description
mocs2 Predicted to enable molybdopterin synthase activity and nucleotide binding activity. Predicted to act upstream of or within Mo-molybdopterin cofactor biosynthetic process. Predicted to be located in cytoplasm. Predicted to be part of molybdopterin synthase complex. Predicted to be active in cytosol.

NR:

description
PREDICTED: molybdopterin synthase sulfur carrier subunit-like

GO: NA

KEGG:

id description
K21232 MOCS2A, CNXG; molybdopterin synthase sulfur carrier subunit

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043250178.1 True 413 mRNA 0.56 3 792323 793795

Neighbor

gene id symbol gene type direction distance location
golph3b LOC107595534,LOC107685144,LOC107713339,LOC107686434,LOC107562594 coding downstream 102195 685911 ~ 690128 (-)
tctn1 LOC107686437 coding downstream 170174 617030 ~ 622149 (-)
csgalnact1a csgalnact1,csgalnact1a,LOC107713273,LOC107686490,LOC107685172,LOC107562546 coding downstream 181060 579303 ~ 611263 (-)
plpp1a plpp1,plpp1a,LOC106561845,LOC107686491 coding downstream 215100 564059 ~ 577223 (-)
dhx29 dhx29,LOC107744100,LOC107686439,LOC107713347,LOC107562543 coding downstream 256364 521051 ~ 535959 (-)
arl15b arl15b,LOC107595536,LOC107713334,LOC107686429,LOC107744085,LOC108433533,LOC107597630 coding upstream 15257 809052 ~ 843011 (-)
LOC122352985 LOC107744083,LOC107597627,LOC107713333,LOC107685138,LOC107595562 coding upstream 54230 848025 ~ 862773 (-)
anxa3b anxa3b,LOC107686424,LOC107597622,LOC107713328,LOC107595539,LOC107685135 coding upstream 109257 903052 ~ 908173 (-)
mrrf mrrf,LOC107686422,LOC107597620,LOC107713327,LOC107595542,LOC107685133 coding upstream 125261 919056 ~ 934066 (-)
morn5 LOC107597617,LOC107685130,LOC107595543 coding upstream 165810 959605 ~ 969638 (-)
G73661 NA non-coding downstream 26671 763883 ~ 765652 (-)
G73684 NA non-coding downstream 48673 742728 ~ 743650 (-)
G73643 NA non-coding downstream 123599 668335 ~ 668724 (-)
G73624 LOC103390470 non-coding downstream 156595 627778 ~ 635728 (-)
G73623 NA non-coding downstream 213177 578060 ~ 579146 (-)
G73704 NA non-coding upstream 2165 795960 ~ 796182 (-)
G73709 NA non-coding upstream 10947 804742 ~ 804954 (-)
G73799 NA non-coding upstream 79269 873064 ~ 873900 (-)
G73803 NA non-coding upstream 87881 881676 ~ 883481 (-)
G73823 NA non-coding upstream 177413 971208 ~ 971820 (-)
G73662 NA other downstream 25977 693448 ~ 766346 (-)
megf10 megf10,LOC107565847,LOC107673753,LOC107705845,LOC107572185 other downstream 395703 359804 ~ 396620 (-)
LOC122353100 golph3,LOC107595534,LOC107685144,LOC107713339,LOC107686434,LOC107552603,LOC107681169,LOC107746803 other downstream 701002 40690 ~ 91321 (-)
si:dkeyp-41f9.4 NA other upstream 91361 885156 ~ 888012 (-)
G74058 NA other upstream 651528 1445323 ~ 1448886 (-)
G74031 NA other upstream 672956 1466751 ~ 1473878 (-)
nrarpa nrarpa,nrarp other upstream 689604 1483399 ~ 1488008 (-)
adamts6 adamts6,LOC107744255,LOC107685101,LOC107713302 other upstream 980428 1774223 ~ 1846902 (-)

Expression


Co-expression Network