G79083 (nwd1,LOC107710443,LOC107658741,LOC107592553,LOC107655543,LOC107730478)


Basic Information

Item Value
gene id G79083
gene name nwd1,LOC107710443,LOC107658741,LOC107592553,LOC107655543,LOC107730478
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056709.1
NCBI id CM032078.1
chromosome length 24513629
location 3779999 ~ 3780317 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU117041
GTGATTCAACAAGACGGGACTCAGGTTCCACAGCTTCTGAACACAGTCCTGAGAGCCAATCAGCGCCTGCACATCCCAGTTGCTCATGGTGATGCAGGTAATGGCTGCACCATGATGATCCAGCTCAGCTGCAGTGGCAGTCTTAAAGTCGTAGATCACCACTTCGCCACCAAATGTTCCATAGAGCAGCCTACAGTCGGACAGCAGGGCCATGGCAGAGATCGGGGAGTGCAGCATGAGCAGAGAATACCTCTCAAATGGGCCGTCCACGCATGGGAAGCTGTCTCTAGATGTAATCTCAAAGAGACAAACTGCATCC

Function

symbol description
nwd1 Orthologous to human NWD1 (NACHT and WD repeat domain containing 1).

NR:

description
PREDICTED: NACHT domain- and WD repeat-containing protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU117041 True 319 lncRNA 0.53 1 3779999 3780317

Neighbor

gene id symbol gene type direction distance location
smim7 smim7,LOC107568062,LOC107703137,LOC107658516,LOC107592586 coding downstream 30288 3747493 ~ 3749711 (-)
bmp7a bmp7a,LOC107730480,LOC107657209,LOC107568055,LOC107751030,LOC107658719 coding downstream 37637 3732982 ~ 3742362 (-)
si:ch211-253b8.5 si:ch211-253b8.5,LOC107653378,LOC107568061,LOC107592587,LOC107680420,LOC107730476 coding downstream 64421 3704572 ~ 3715578 (-)
cdh27 LOC107654208,LOC107730486,LOC107568064 coding downstream 77793 3691160 ~ 3702206 (-)
LOC122353608 LOC107658808,LOC107568054,LOC107750169 coding downstream 91719 3683809 ~ 3688280 (-)
zgc:113223 zgc:113223,LOC107698001,LOC107556176,LOC107745344 coding upstream 5214 3785531 ~ 3791150 (-)
apc2 apc2,LOC107745340,LOC107592552,LOC107556194,LOC107710448,LOC107658524,LOC107698002 coding upstream 141983 3922300 ~ 3950755 (-)
vtg3 vtg3,LOC107745337,LOC107556190,LOC107669019,LOC107710446 coding upstream 192439 3972756 ~ 3983180 (-)
adgrl4 adgrl4,LOC107556188,LOC107745336,LOC107710447,LOC107592582 coding upstream 205173 3985490 ~ 4002645 (-)
ttll7 ttll7,LOC107745334,LOC107669020 coding upstream 512031 4292348 ~ 4367165 (-)
G79075 tmem38a,LOC107730482,LOC107702305,LOC107658508,LOC107751025 non-coding downstream 20276 3752930 ~ 3759723 (-)
G79069 NA non-coding downstream 60585 3716689 ~ 3719414 (-)
G79010 NA non-coding downstream 122710 3654282 ~ 3657289 (-)
G78969 NA non-coding downstream 365075 3412874 ~ 3414924 (-)
G78919 NA non-coding downstream 512324 3266756 ~ 3267675 (-)
G79126 NA non-coding upstream 328787 4109104 ~ 4112070 (-)
G79172 NA non-coding upstream 594331 4374648 ~ 4375393 (-)
G79227 NA non-coding upstream 607784 4388101 ~ 4388739 (-)
G79236 NA non-coding upstream 619189 4399506 ~ 4400590 (-)
G79256 NA non-coding upstream 684470 4464787 ~ 4469281 (-)
G79003 NA other downstream 238944 3540001 ~ 3541055 (-)
cdab cda,LOC107714500,LOC107751011,LOC107572847,LOC107680435,LOC108436250,LOC105898129 other downstream 523787 3253863 ~ 3256212 (-)
G78853 gata2a,gata2,LOC107714496 other downstream 666307 3112933 ~ 3113692 (-)
spcs1 spcs1,LOC107566449,LOC107714491,LOC107680421,LOC107699355,LOC107744856,LOC107572401 other downstream 731775 3046738 ~ 3048224 (-)
trnai-aau_68 NA other downstream 793468 2986458 ~ 2986531 (-)
LOC122354343 cpne5b,LOC107680428,LOC107714485,LOC107555996,LOC107699334,LOC107751002,LOC108436414 other upstream 33188 3813505 ~ 3834923 (-)
G79085 zgc:113223,LOC107745344,LOC107698001,LOC107556176 other upstream 132931 3913248 ~ 3914635 (-)
si:dkey-197i20.6 si:dkey-197i20.6,LOC107745350,LOC107710445,LOC107658773,LOC107669007,LOC107592569 other upstream 181664 3961981 ~ 3965791 (-)
mmel1 mmel1,LOC107712974,LOC107756657,LOC107654428,LOC107702001,LOC107592889 other upstream 1958699 5739016 ~ 5765140 (-)
G79565 NA other upstream 2315816 6096133 ~ 6096480 (-)

Expression


Co-expression Network