G82372 (naaladl2,LOC107600312,LOC107674503)


Basic Information

Item Value
gene id G82372
gene name naaladl2,LOC107600312,LOC107674503
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056709.1
NCBI id CM032078.1
chromosome length 24513629
location 16243701 ~ 16243954 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU121974
CCACTAGGTTTCCCACAGCCGAATAAGCCGCAAAGGCAAATGGTTCAGTCGTGGATTCGAACGGCTGGTCGCACTTCGCTCCGCTGGGCAGGTAACACTGGTTTCCACTTATATCGGTGATGGTGCTGAGGGCGGGGCCAGGATAGCTCAAGAGAGCCGTGTGATTGGTCACCTGGACGTCTTTTAATCCGAACTCCTCCCACCTCTGAGCGATGTACCTGACCTTGGACTACTCTGTGAGATCGGACAAGCTG

Function

symbol description
naaladl2 Predicted to enable metalloexopeptidase activity. Predicted to be involved in proteolysis. Predicted to act upstream of or within response to bacterium. Located in nucleoplasm.

NR:

description
PREDICTED: inactive N-acetylated-alpha-linked acidic dipeptidase-like protein 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU121974 True 254 lncRNA 0.55 1 16243701 16243954

Neighbor

gene id symbol gene type direction distance location
LOC122353772 spata16,LOC107593153 coding downstream 294111 15842161 ~ 15949590 (-)
b3gnt5a b3gnt5a,LOC107593139,LOC107656073,LOC107753797,LOC107674530,LOC107718888,LOC107563744 coding downstream 462012 15776187 ~ 15781689 (-)
LOC122353685 NA coding downstream 595356 15646561 ~ 15648345 (-)
LOC122353771 NA coding downstream 612433 15630130 ~ 15631268 (-)
zgc:193807 NA coding downstream 619688 15622922 ~ 15624013 (-)
tbl1xr1a tbl1xr1,LOC107600277,LOC107718892,LOC106584305,LOC107557783 coding upstream 187700 16431654 ~ 16472967 (-)
LOC122354663 LOC107753811,LOC107656084,LOC107593146 coding upstream 310454 16554408 ~ 16555675 (-)
LOC122354689 kcnmb2,LOC107600278,LOC107656067,LOC107699784 coding upstream 411178 16655132 ~ 16660615 (-)
LOC122354367 LOC103358720 coding upstream 522419 16766373 ~ 16769063 (-)
LOC122353589 LOC103358720 coding upstream 645636 16889590 ~ 16891932 (-)
G82370 naaladl2,LOC107674503 non-coding downstream 28090 16215116 ~ 16215611 (-)
G82347 NA non-coding downstream 112220 16130782 ~ 16131481 (-)
G82311 NA non-coding downstream 451612 15789545 ~ 15792089 (-)
G82296 NA non-coding downstream 504960 15734557 ~ 15738741 (-)
G82286 LOC107593138,LOC107655962,LOC107753871 non-coding downstream 510943 15717597 ~ 15732758 (-)
G82374 NA non-coding upstream 39462 16283416 ~ 16283618 (-)
LOC122354638 NA non-coding upstream 88190 16332144 ~ 16334070 (-)
G82376 NA non-coding upstream 91439 16335393 ~ 16335614 (-)
G82381 NA non-coding upstream 95903 16339857 ~ 16340105 (-)
G82378 NA non-coding upstream 97893 16341847 ~ 16345720 (-)
LOC122354045 NA other downstream 628764 15595565 ~ 15614937 (-)
pla2r1 pla2r1,LOC107674555,LOC107564855,LOC107747570 other downstream 666636 15552356 ~ 15577065 (-)
LOC122354564 NA other downstream 842010 15400918 ~ 15401691 (-)
LOC122354561 NA other downstream 1008265 15233933 ~ 15235436 (-)
G82067 NA other downstream 1029643 15204961 ~ 15214058 (-)
LOC122353775 srsf1,srsf1a,LOC107704814,LOC102236359,LOC103148541,LOC106947524,LOC106593141,LOC107661108,LOC107731957,LOC108431323,LOC107554282,LOC107727915,LOC108278759 other upstream 346852 16590806 ~ 16593930 (-)
LOC122353776 NA other upstream 360050 16604004 ~ 16606580 (-)
LOC122354244 rab7a,rab7,LOC102230535,LOC108254780,LOC106583206,LOC105017191,LOC106582926 other upstream 534958 16778912 ~ 16912574 (-)
G82585 LOC107691335,LOC107685641,LOC107556181,LOC107749503 other upstream 1293549 17537503 ~ 17540171 (-)
G82588 phf2,LOC107556181,LOC107685641 other upstream 1306627 17550581 ~ 17559836 (-)

Expression


Co-expression Network