G8439 (LOC107722542)


Basic Information

Item Value
gene id G8439
gene name LOC107722542
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 1309945 ~ 1310291 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU12664
GATTATTACTGCACTTTTGGCCCAAACAGTCCCTTCCTCCTGATGAGGCAGCAGCAAAGGCAGATACGCAGATCTGAACCTCTGGGCGAAGAACTCCGCCAGTAAAAGAGCCTGATGTGCAACCAATTCTGCTGCCAAGCTGTTCTCTCCGATCTGCAGGCTTGCACAGAGCGGCCGGCGTAATTGGAAAGATCAAACGTGCTTTTGTGCAGCGTGGGGAATGCGGAGCTTCGGCGCAGAGGGAGATCTGACTTGGGAAATCAGGGAGATACACAAGAGATAGAGAAGCTCTGATCAGACAAACCGCCTTCCAAGTCTGCTCGTAAAGAAATAAGGGCTGGTGATTC

Function

NR:

description
PREDICTED: ephrin type-B receptor 3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU12664 True 347 lncRNA 0.29 1 1309945 1310291
Loading

Neighbor

gene id symbol gene type direction distance location
pcolce2a pcolce2a,LOC107681764,LOC107599838,LOC107709043,LOC107565816 coding downstream 36790 1264644 ~ 1273155 (-)
chst2a chst2a,LOC107681814,LOC107599839,LOC107656863,LOC107722292 coding downstream 62683 1245074 ~ 1247262 (-)
fubp1 fubp1,LOC107681766,LOC107703234 coding downstream 294559 1006589 ~ 1015386 (-)
usp33 usp33,LOC107708728,LOC107751869,LOC107681685 coding downstream 314197 974125 ~ 995748 (-)
zzz3 zzz3,LOC107681788,LOC107599843,LOC107703198,LOC107708932,LOC107703238 coding downstream 336602 953716 ~ 973343 (-)
kcnmb2 kcnmb2,LOC107656859,LOC107568625 coding upstream 34851 1345142 ~ 1347767 (-)
eif4a2 eif4a2,LOC107568626,LOC107593804,LOC108267852,LOC105889495 coding upstream 72286 1382577 ~ 1388864 (-)
LOC122328985 NA coding upstream 73417 1383708 ~ 1383784 (-)
LOC122328960 NA coding upstream 73799 1384090 ~ 1384275 (-)
LOC122328955 NA coding upstream 74406 1384697 ~ 1384875 (-)
G8415 NA non-coding downstream 61355 1248176 ~ 1248590 (-)
G8386 NA non-coding downstream 263038 1046590 ~ 1046907 (-)
G8385 NA non-coding downstream 266995 1042745 ~ 1042950 (-)
G8375 NA non-coding downstream 310256 998369 ~ 999689 (-)
G8309 NA non-coding downstream 532987 774259 ~ 776958 (-)
G8443 NA non-coding upstream 22554 1332845 ~ 1333104 (-)
G8479 NA non-coding upstream 89117 1399408 ~ 1399728 (-)
G8489 LOC107696015,LOC107710542,LOC107721879 non-coding upstream 151769 1462060 ~ 1462514 (-)
G8599 NA non-coding upstream 529881 1840172 ~ 1876938 (-)
G8623 ppm1la,ppm1l,LOC107681725,LOC107722109,LOC107701333,LOC101065476,LOC106534897 non-coding upstream 612993 1923284 ~ 1929991 (-)
dipk2aa dia1a,LOC107681802,LOC107599840,LOC107722302,LOC107565821,LOC108437525,LOC108268022 other downstream 106958 1179945 ~ 1202987 (-)
LOC122325167 NA other downstream 706001 119350 ~ 603944 (-)
mfsd8l2 si:ch211-38m6.6,LOC107681768,LOC107656858,LOC107565819,LOC107722537,LOC107599859,LOC108437504,LOC105026921 other upstream 21139 1331430 ~ 1337998 (-)
colgalt2a LOC107593860,LOC107681694,LOC107715500 other upstream 215457 1525748 ~ 1532557 (-)
gng5 NA other upstream 612004 1922295 ~ 1940721 (-)
slc1a7a slc1a7a,slc1a7,LOC107722044,LOC107671767,LOC107681716,LOC107593788 other upstream 706117 2016408 ~ 2038705 (-)
tmem125b tmem125b,LOC107719275,LOC107681700,LOC107681734,LOC107719290,LOC107593887 other upstream 740139 2050430 ~ 2055709 (-)

Expression

G8439(LOC107722542) Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G8439(LOC107722542) Expression in each Bioproject

Bar chart with 2 bars.
G8439(LOC107722542) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network