G9892


Basic Information

Item Value
gene id G9892
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 6755823 ~ 6756092 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU14739
ccggggagcagggcaatcgggggaaatgcgtacaggcgacgccttggccacgcctgtgacatggcatccagtcccaggggagctggatgaactagagagaaccagaggggacattgtgcattccctcgagaagcaaagaggtccacctctgcctggtaaaatctcgaccagatctgcttcaccacgtcggggtgaagcatccattcccccggcctcaacccctgtctcgacagggtgtcggctcccgtattgagatgcccagggatgtag

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0051090 regulation of DNA-binding transcription factor activity biological_process

KEGG:

id description
ko04350 TGF-beta signaling pathway

RNA

RNA id representative length rna type GC content exon number start site end site
TU14739 True 270 lncRNA 0.43 1 6755823 6756092

Neighbor

gene id symbol gene type direction distance location
slc35d1b slc35d1b,LOC107690965,LOC107573325,LOC107745697,LOC108415103 coding upstream 267123 6474022 ~ 6488700 (+)
fgf12a fgf12a,fgf12,LOC107549734,LOC108436038,LOC105006885,LOC108280711,LOC106598267,LOC106568709,LOC103365152 coding upstream 418251 6257551 ~ 6337572 (+)
mb21d2 mb21d2,LOC107705301,LOC107572431,LOC107673980,LOC105899163 coding upstream 500250 6249048 ~ 6255573 (+)
crfb16 LOC107676306,LOC107758261,LOC107568418 coding upstream 516129 6235870 ~ 6239694 (+)
trnag-gcc_19 NA coding upstream 642116 6113637 ~ 6113707 (+)
LOC122361319 NA coding downstream 84534 6840626 ~ 6842093 (+)
bpnt2 impad1,LOC107663252,LOC107741594 coding downstream 100152 6856244 ~ 6879649 (+)
penka LOC107748924,LOC107675675,LOC107573453 coding downstream 214401 6970493 ~ 6973171 (+)
cryz cryz,LOC107553670 coding downstream 328042 7084134 ~ 7098176 (+)
fam151a fam151a coding downstream 350119 7106211 ~ 7111272 (+)
G9890 NA non-coding upstream 13650 6741733 ~ 6742173 (+)
G9884 NA non-coding upstream 106023 6649446 ~ 6649800 (+)
LOC122357847 NA non-coding upstream 200893 6539289 ~ 6554930 (+)
G9847 NA non-coding upstream 204472 6546230 ~ 6551351 (+)
G9840 NA non-coding upstream 228191 6527369 ~ 6527632 (+)
G9893 NA non-coding downstream 72355 6828447 ~ 6829096 (+)
G9901 NA non-coding downstream 86059 6842151 ~ 6842425 (+)
G9918 NA non-coding downstream 169877 6925969 ~ 6926177 (+)
G9928 NA non-coding downstream 244968 7001060 ~ 7001479 (+)
G9930 NA non-coding downstream 253268 7009360 ~ 7010594 (+)
G9889 NA other upstream 63448 6691668 ~ 6692375 (+)
G9887 NA other upstream 65044 6690372 ~ 6690779 (+)
sst2 LOC107549725,LOC107710806 other upstream 387869 6367177 ~ 6367954 (+)
trnag-gcc_21 NA other upstream 533304 6222445 ~ 6222519 (+)
trnag-gcc_20 NA other upstream 535323 6220426 ~ 6220500 (+)
G9925 LOC107563058,LOC107549254 other downstream 230206 6986298 ~ 6987119 (+)
lrrc53 LOC107700485,LOC107588905,LOC107716924 other downstream 342211 7098303 ~ 7105792 (+)
gng12a gng12a,LOC107700509,LOC107716954,LOC107551713 other downstream 529578 7285670 ~ 7300101 (+)
G10108 NA other downstream 748530 7504622 ~ 7582385 (+)
G10212 NA other downstream 1350773 8106865 ~ 8107777 (+)

Expression


Co-expression Network